RiceVarMap2

Search for Variation information by Variation ID:

Detailed information for vg0804076961:

Variant ID: vg0804076961 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 4076961
Reference Allele: G	Alternative Allele: T,A
Primary Allele: G	Secondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 345. )

Flanking Sequence (100 bp) in Reference Genome:

ATATCCTCGGAACTCATGAAAACTTGAATTGCAGCACAAAAGCTAACTCCAGAGGCCACCAGGCAATCCCTAGAAAAGGCTGATGACTTGAGAACAGTCA[G/T,A]
TATCGTCCTAACAACATGCTTGAAGACAGTAGATGCTTTGTCAAGTTCAGTAAACTTAGAAGGGTAGCGCTGCAGCAAGTAGTACATGCAAGACATAGCC

Reverse complement sequence

GGCTATGTCTTGCATGTACTACTTGCTGCAGCGCTACCCTTCTAAGTTTACTGAACTTGACAAAGCATCTACTGTCTTCAAGCATGTTGTTAGGACGATA[C/A,T]
TGACTGTTCTCAAGTCATCAGCCTTTTCTAGGGATTGCCTGGTGGCCTCTGGAGTTAGCTTTTGTGCTGCAATTCAAGTTTTCATGAGTTCCGAGGATAT

Allele Frequencies:

Search:

Populations	Population Size	Frequency of G(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	97.60%	1.50%	0.93%	0.00%	NA
All Indica	2759	99.80%	0.00%	0.18%	0.00%	NA
All Japonica	1512	92.90%	4.60%	2.51%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	99.80%	0.00%	0.17%	0.00%	NA
Indica II	465	99.60%	0.00%	0.43%	0.00%	NA
Indica III	913	100.00%	0.00%	0.00%	0.00%	NA
Indica Intermediate	786	99.60%	0.10%	0.25%	0.00%	NA
Temperate Japonica	767	90.10%	5.60%	4.30%	0.00%	NA
Tropical Japonica	504	99.20%	0.80%	0.00%	0.00%	NA
Japonica Intermediate	241	88.80%	9.10%	2.07%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	98.90%	0.00%	1.11%	0.00%	NA

Showing 1 to 13 of 13 entries

Allele Effect:

Search:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0804076961	G -> T	LOC_Os08g07290.1	missense_variant ; p.Leu235Met; MODERATE	nonsynonymous_codon ; L235M	Average:62.861; most accessible tissue: Callus, score: 83.768	probably damaging	2.14	TOLERATED	0.07
vg0804076961	G -> A	LOC_Os08g07290.1	synonymous_variant ; p.Leu235Leu; LOW	N	Average:62.861; most accessible tissue: Callus, score: 83.768	N	N	N	N
vg0804076961	G -> A	LOC_Os08g07300.1	upstream_gene_variant ; 1704.0bp to feature; MODIFIER	N	Average:62.861; most accessible tissue: Callus, score: 83.768	N	N	N	N
vg0804076961	G -> A	LOC_Os08g07290.2	upstream_gene_variant ; 847.0bp to feature; MODIFIER	N	Average:62.861; most accessible tissue: Callus, score: 83.768	N	N	N	N
vg0804076961	G -> A	LOC_Os08g07300.2	upstream_gene_variant ; 1704.0bp to feature; MODIFIER	N	Average:62.861; most accessible tissue: Callus, score: 83.768	N	N	N	N

Showing 1 to 5 of 5 entries

Putative Genotype-Phenotype Associations:

Show entries

Search:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0804076961	6.21E-06	NA	mr1031	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804076961	1.83E-06	NA	mr1056	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804076961	7.50E-07	7.50E-07	mr1197_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804076961	1.22E-06	5.95E-06	mr1546_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251

Showing 1 to 4 of 4 entries

Previous1Next

Search for Variation information by Variation ID:

Detailed information for vg0804076961:

Flanking Sequence (100 bp) in Reference Genome:

Reverse complement sequence

Allele Frequencies:

Allele Effect:

Putative Genotype-Phenotype Associations:

RiceVarMap v2.0

Tools

Blast

Design Primer by Variation ID

Design Primer by Region

Haplotype Network Analysis

Varitation Coordinate Convert

Contact