Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0804032788:

Variant ID: vg0804032788 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 4032788
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GCTGTTAAAATCCTTTTTAATGCGGTTTGATAATTCTTTGGAATTAACACGATGCAAACAAAAGGTGCCCGACAGGAAGGTGTTATACTATTTTTGTAAG[C/T]
CTTATTAGGCTGCAAAAGCTGTTTGGGTTGATTTGAGATGACTAATTTATTAAGGGTCATTCTCTTAGCATGTTATATGCTTAATTTGGTTATGGTGAGA

Reverse complement sequence

TCTCACCATAACCAAATTAAGCATATAACATGCTAAGAGAATGACCCTTAATAAATTAGTCATCTCAAATCAACCCAAACAGCTTTTGCAGCCTAATAAG[G/A]
CTTACAAAAATAGTATAACACCTTCCTGTCGGGCACCTTTTGTTTGCATCGTGTTAATTCCAAAGAATTATCAAACCGCATTAAAAAGGATTTTAACAGC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	65.70%	2.00%	3.94%	28.35%	NA
All Indica	2759	54.70%	0.10%	3.37%	41.86%	NA
All Japonica	1512	88.00%	6.10%	4.96%	0.93%	NA
Aus	269	53.20%	0.00%	1.12%	45.72%	NA
Indica I	595	33.90%	0.20%	3.53%	62.35%	NA
Indica II	465	86.00%	0.20%	0.65%	13.12%	NA
Indica III	913	53.00%	0.00%	4.38%	42.61%	NA
Indica Intermediate	786	53.80%	0.00%	3.69%	42.49%	NA
Temperate Japonica	767	97.50%	0.00%	1.17%	1.30%	NA
Tropical Japonica	504	68.70%	18.30%	12.50%	0.60%	NA
Japonica Intermediate	241	98.30%	0.00%	1.24%	0.41%	NA
VI/Aromatic	96	59.40%	0.00%	7.29%	33.33%	NA
Intermediate	90	72.20%	1.10%	8.89%	17.78%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0804032788	C -> T	LOC_Os08g07230.1	upstream_gene_variant ; 470.0bp to feature; MODIFIER	silent_mutation	Average:23.288; most accessible tissue: Minghui63 panicle, score: 46.754	N	N	N	N
vg0804032788	C -> T	LOC_Os08g07220.1	downstream_gene_variant ; 4089.0bp to feature; MODIFIER	silent_mutation	Average:23.288; most accessible tissue: Minghui63 panicle, score: 46.754	N	N	N	N
vg0804032788	C -> T	LOC_Os08g07240.1	downstream_gene_variant ; 4489.0bp to feature; MODIFIER	silent_mutation	Average:23.288; most accessible tissue: Minghui63 panicle, score: 46.754	N	N	N	N
vg0804032788	C -> T	LOC_Os08g07230-LOC_Os08g07240	intergenic_region ; MODIFIER	silent_mutation	Average:23.288; most accessible tissue: Minghui63 panicle, score: 46.754	N	N	N	N
vg0804032788	C -> DEL	N	N	silent_mutation	Average:23.288; most accessible tissue: Minghui63 panicle, score: 46.754	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0804032788	NA	2.05E-08	mr1076	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804032788	NA	2.27E-08	mr1082	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804032788	NA	1.55E-08	mr1083	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804032788	3.41E-06	2.42E-09	mr1226	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804032788	7.39E-08	5.03E-08	mr1411	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804032788	9.38E-06	9.38E-06	mr1436	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804032788	NA	6.41E-06	mr1560	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804032788	9.31E-06	1.35E-06	mr1878	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804032788	2.49E-08	2.49E-08	mr1076_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804032788	9.26E-07	1.56E-11	mr1082_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804032788	NA	1.67E-08	mr1083_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804032788	NA	2.03E-06	mr1103_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804032788	NA	5.02E-07	mr1104_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804032788	NA	8.01E-06	mr1107_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804032788	NA	1.80E-08	mr1226_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804032788	2.17E-06	1.71E-08	mr1800_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251