\
| Variant ID: vg0804028565 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 4028565 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
CGTGGCACACCCCATGAGTAATGGACAAGTTGAGCGCGCCAATGGCATGGTACTTAAAGGGATAAAAGCACAAGTTTTCGACCGACTACGTCCCTATGTT[G/A]
GCAAGTGGGTAGATCAGCTGCCGTCCATACTTTGGTCGTTACGCACTACTCCCAGTCGGGCTACCGGCCAGTCGCCGTTCTTTTTGGTCTATGGTGCAGA
TCTGCACCATAGACCAAAAAGAACGGCGACTGGCCGGTAGCCCGACTGGGAGTAGTGCGTAACGACCAAAGTATGGACGGCAGCTGATCTACCCACTTGC[C/T]
AACATAGGGACGTAGTCGGTCGAAAACTTGTGCTTTTATCCCTTTAAGTACCATGCCATTGGCGCGCTCAACTTGTCCATTACTCATGGGGTGTGCCACG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 41.00% | 4.30% | 14.39% | 40.37% | NA |
| All Indica | 2759 | 24.40% | 0.20% | 16.24% | 59.19% | NA |
| All Japonica | 1512 | 79.60% | 12.60% | 3.90% | 3.97% | NA |
| Aus | 269 | 3.00% | 0.00% | 47.21% | 49.81% | NA |
| Indica I | 595 | 12.90% | 0.20% | 10.92% | 75.97% | NA |
| Indica II | 465 | 74.40% | 0.40% | 6.88% | 18.28% | NA |
| Indica III | 913 | 7.40% | 0.00% | 22.89% | 69.66% | NA |
| Indica Intermediate | 786 | 23.20% | 0.30% | 18.07% | 58.52% | NA |
| Temperate Japonica | 767 | 95.80% | 0.00% | 2.09% | 2.09% | NA |
| Tropical Japonica | 504 | 48.40% | 36.90% | 6.15% | 8.53% | NA |
| Japonica Intermediate | 241 | 92.90% | 1.70% | 4.98% | 0.41% | NA |
| VI/Aromatic | 96 | 11.50% | 0.00% | 28.12% | 60.42% | NA |
| Intermediate | 90 | 45.60% | 7.80% | 21.11% | 25.56% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0804028565 | G -> A | LOC_Os08g07220.1 | missense_variant ; p.Gly936Ser; MODERATE | nonsynonymous_codon ; G936S | Average:27.455; most accessible tissue: Minghui63 flag leaf, score: 52.137 | benign |
0.729 |
TOLERATED | 0.07 |
| vg0804028565 | G -> DEL | LOC_Os08g07220.1 | N | frameshift_variant | Average:27.455; most accessible tissue: Minghui63 flag leaf, score: 52.137 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0804028565 | NA | 2.46E-06 | mr1076 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0804028565 | NA | 3.51E-07 | mr1082 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0804028565 | NA | 3.27E-07 | mr1083 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0804028565 | NA | 2.00E-07 | mr1226 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0804028565 | 8.12E-08 | 8.12E-08 | mr1076_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0804028565 | 9.32E-06 | 1.53E-08 | mr1082_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0804028565 | 3.13E-08 | 2.18E-09 | mr1083_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0804028565 | 6.91E-07 | NA | mr1085_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0804028565 | 4.88E-07 | NA | mr1103_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0804028565 | 6.77E-07 | NA | mr1104_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0804028565 | 7.57E-06 | 7.57E-06 | mr1145_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0804028565 | 2.37E-07 | NA | mr1155_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0804028565 | 4.10E-07 | 1.77E-07 | mr1226_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0804028565 | 2.75E-06 | 1.77E-06 | mr1408_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0804028565 | 4.50E-07 | NA | mr1437_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |