\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0804007001:

Variant ID: vg0804007001 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 4007001
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.95, T: 0.05, others allele: 0.00, population size: 109. )

Flanking Sequence (100 bp) in Reference Genome:


ACTTTTCATAATGACTAAAATACCCTCGACCAAACCCTATCCATATATATTCCCTTCTCTCCCTCGTATCCCGTCTCTCTCTCTCGCCGAGTGCTTGCGG[C/T]
GGCGGCAGCGACGGGTGGAGGGAGGGAGCGGCCGTGAGCGGCGGCCGCGAGGCGGGGAGGGAGGGATCCGCGCGGTGCTGGCTCGCTGAGGGAGGGAGCA

Reverse complement sequence

TGCTCCCTCCCTCAGCGAGCCAGCACCGCGCGGATCCCTCCCTCCCCGCCTCGCGGCCGCCGCTCACGGCCGCTCCCTCCCTCCACCCGTCGCTGCCGCC[G/A]
CCGCAAGCACTCGGCGAGAGAGAGAGACGGGATACGAGGGAGAGAAGGGAATATATATGGATAGGGTTTGGTCGAGGGTATTTTAGTCATTATGAAAAGT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 55.50% 43.80% 0.53% 0.21% NA
All Indica  2759 36.40% 62.60% 0.65% 0.36% NA
All Japonica  1512 94.90% 5.00% 0.07% 0.00% NA
Aus  269 21.20% 77.00% 1.86% 0.00% NA
Indica I  595 62.90% 36.80% 0.17% 0.17% NA
Indica II  465 76.10% 23.20% 0.43% 0.22% NA
Indica III  913 3.20% 95.70% 0.77% 0.33% NA
Indica Intermediate  786 31.40% 66.90% 1.02% 0.64% NA
Temperate Japonica  767 97.80% 2.20% 0.00% 0.00% NA
Tropical Japonica  504 88.70% 11.10% 0.20% 0.00% NA
Japonica Intermediate  241 98.80% 1.20% 0.00% 0.00% NA
VI/Aromatic  96 68.80% 31.20% 0.00% 0.00% NA
Intermediate  90 67.80% 31.10% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0804007001 C -> T LOC_Os08g07160.1 upstream_gene_variant ; 1313.0bp to feature; MODIFIER silent_mutation Average:71.67; most accessible tissue: Minghui63 young leaf, score: 82.087 N N N N
vg0804007001 C -> T LOC_Os08g07170.1 upstream_gene_variant ; 4370.0bp to feature; MODIFIER silent_mutation Average:71.67; most accessible tissue: Minghui63 young leaf, score: 82.087 N N N N
vg0804007001 C -> T LOC_Os08g07160-LOC_Os08g07170 intergenic_region ; MODIFIER silent_mutation Average:71.67; most accessible tissue: Minghui63 young leaf, score: 82.087 N N N N
vg0804007001 C -> DEL N N silent_mutation Average:71.67; most accessible tissue: Minghui63 young leaf, score: 82.087 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0804007001 C T -0.02 -0.03 -0.02 -0.02 -0.02 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0804007001 NA 5.62E-13 Heading_date Ind_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0804007001 NA 1.96E-06 mr1063 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804007001 NA 1.21E-07 mr1063_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804007001 NA 5.01E-09 mr1221_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804007001 NA 5.99E-07 mr1242_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804007001 NA 2.00E-07 mr1252_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804007001 NA 4.29E-07 mr1358_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804007001 NA 9.29E-06 mr1422_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804007001 NA 2.60E-07 mr1482_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804007001 NA 1.87E-07 mr1511_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804007001 NA 1.47E-06 mr1588_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804007001 1.40E-06 1.39E-06 mr1615_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804007001 NA 1.56E-12 mr1624_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804007001 NA 3.89E-07 mr1624_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804007001 NA 6.56E-12 mr1844_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804007001 NA 1.19E-06 mr1870_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804007001 NA 1.66E-18 mr1874_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251