\
| Variant ID: vg0804004654 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 4004654 |
| Reference Allele: G | Alternative Allele: T,A |
| Primary Allele: G | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
AAGGTGAATTTAATTACTTTTCCAATTAAATTAATCACTGAAATGATCTTTGAATTGTTAAAAATACTTCCAATGCTCAAATAATTTCAAGAAAAATCCT[G/T,A]
AAAATACTTGAAAACTATAAATATTTAAAACAATTATAATCAGACCATTTAATGATTAATTTAATATGTGAATAATTACTGAAATGTTGTTTGTATTATT
AATAATACAAACAACATTTCAGTAATTATTCACATATTAAATTAATCATTAAATGGTCTGATTATAATTGTTTTAAATATTTATAGTTTTCAAGTATTTT[C/A,T]
AGGATTTTTCTTGAAATTATTTGAGCATTGGAAGTATTTTTAACAATTCAAAGATCATTTCAGTGATTAATTTAATTGGAAAAGTAATTAAATTCACCTT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 43.40% | 6.90% | 23.61% | 26.09% | A: 0.06% |
| All Indica | 2759 | 30.60% | 0.10% | 30.88% | 38.35% | NA |
| All Japonica | 1512 | 73.30% | 20.80% | 3.97% | 1.98% | NA |
| Aus | 269 | 11.90% | 0.40% | 47.21% | 39.41% | A: 1.12% |
| Indica I | 595 | 19.70% | 0.30% | 50.76% | 29.24% | NA |
| Indica II | 465 | 77.20% | 0.00% | 9.46% | 13.33% | NA |
| Indica III | 913 | 13.80% | 0.00% | 35.71% | 50.49% | NA |
| Indica Intermediate | 786 | 30.90% | 0.30% | 22.90% | 45.93% | NA |
| Temperate Japonica | 767 | 62.10% | 34.80% | 1.04% | 2.09% | NA |
| Tropical Japonica | 504 | 82.50% | 5.40% | 9.92% | 2.18% | NA |
| Japonica Intermediate | 241 | 89.60% | 8.30% | 0.83% | 1.24% | NA |
| VI/Aromatic | 96 | 14.60% | 3.10% | 60.42% | 21.88% | NA |
| Intermediate | 90 | 55.60% | 3.30% | 21.11% | 20.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0804004654 | G -> T | LOC_Os08g07140.1 | upstream_gene_variant ; 3269.0bp to feature; MODIFIER | silent_mutation | Average:55.692; most accessible tissue: Minghui63 young leaf, score: 95.434 | N | N | N | N |
| vg0804004654 | G -> T | LOC_Os08g07160.1 | downstream_gene_variant ; 762.0bp to feature; MODIFIER | silent_mutation | Average:55.692; most accessible tissue: Minghui63 young leaf, score: 95.434 | N | N | N | N |
| vg0804004654 | G -> T | LOC_Os08g07140-LOC_Os08g07160 | intergenic_region ; MODIFIER | silent_mutation | Average:55.692; most accessible tissue: Minghui63 young leaf, score: 95.434 | N | N | N | N |
| vg0804004654 | G -> A | LOC_Os08g07140.1 | upstream_gene_variant ; 3269.0bp to feature; MODIFIER | silent_mutation | Average:55.692; most accessible tissue: Minghui63 young leaf, score: 95.434 | N | N | N | N |
| vg0804004654 | G -> A | LOC_Os08g07160.1 | downstream_gene_variant ; 762.0bp to feature; MODIFIER | silent_mutation | Average:55.692; most accessible tissue: Minghui63 young leaf, score: 95.434 | N | N | N | N |
| vg0804004654 | G -> A | LOC_Os08g07140-LOC_Os08g07160 | intergenic_region ; MODIFIER | silent_mutation | Average:55.692; most accessible tissue: Minghui63 young leaf, score: 95.434 | N | N | N | N |
| vg0804004654 | G -> DEL | N | N | silent_mutation | Average:55.692; most accessible tissue: Minghui63 young leaf, score: 95.434 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0804004654 | 1.34E-06 | 6.67E-11 | mr1002 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0804004654 | NA | 6.24E-09 | mr1002 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0804004654 | 4.25E-06 | NA | mr1035 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0804004654 | 2.23E-06 | 5.73E-13 | mr1182 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0804004654 | NA | 6.65E-07 | mr1182 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0804004654 | NA | 3.53E-10 | mr1282 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0804004654 | NA | 1.09E-06 | mr1330 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0804004654 | 2.43E-06 | NA | mr1626 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0804004654 | NA | 1.27E-06 | mr1626 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0804004654 | 1.77E-06 | 8.21E-13 | mr1650 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0804004654 | NA | 1.56E-06 | mr1650 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0804004654 | NA | 2.69E-10 | mr1658 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0804004654 | NA | 9.42E-06 | mr1658 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0804004654 | NA | 7.20E-10 | mr1002_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |