Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0804004654:

Variant ID: vg0804004654 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 4004654
Reference Allele: G	Alternative Allele: T,A
Primary Allele: G	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

AAGGTGAATTTAATTACTTTTCCAATTAAATTAATCACTGAAATGATCTTTGAATTGTTAAAAATACTTCCAATGCTCAAATAATTTCAAGAAAAATCCT[G/T,A]
AAAATACTTGAAAACTATAAATATTTAAAACAATTATAATCAGACCATTTAATGATTAATTTAATATGTGAATAATTACTGAAATGTTGTTTGTATTATT

Reverse complement sequence

AATAATACAAACAACATTTCAGTAATTATTCACATATTAAATTAATCATTAAATGGTCTGATTATAATTGTTTTAAATATTTATAGTTTTCAAGTATTTT[C/A,T]
AGGATTTTTCTTGAAATTATTTGAGCATTGGAAGTATTTTTAACAATTCAAAGATCATTTCAGTGATTAATTTAATTGGAAAAGTAATTAAATTCACCTT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	43.40%	6.90%	23.61%	26.09%	A: 0.06%
All Indica	2759	30.60%	0.10%	30.88%	38.35%	NA
All Japonica	1512	73.30%	20.80%	3.97%	1.98%	NA
Aus	269	11.90%	0.40%	47.21%	39.41%	A: 1.12%
Indica I	595	19.70%	0.30%	50.76%	29.24%	NA
Indica II	465	77.20%	0.00%	9.46%	13.33%	NA
Indica III	913	13.80%	0.00%	35.71%	50.49%	NA
Indica Intermediate	786	30.90%	0.30%	22.90%	45.93%	NA
Temperate Japonica	767	62.10%	34.80%	1.04%	2.09%	NA
Tropical Japonica	504	82.50%	5.40%	9.92%	2.18%	NA
Japonica Intermediate	241	89.60%	8.30%	0.83%	1.24%	NA
VI/Aromatic	96	14.60%	3.10%	60.42%	21.88%	NA
Intermediate	90	55.60%	3.30%	21.11%	20.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0804004654	G -> T	LOC_Os08g07140.1	upstream_gene_variant ; 3269.0bp to feature; MODIFIER	silent_mutation	Average:55.692; most accessible tissue: Minghui63 young leaf, score: 95.434	N	N	N	N
vg0804004654	G -> T	LOC_Os08g07160.1	downstream_gene_variant ; 762.0bp to feature; MODIFIER	silent_mutation	Average:55.692; most accessible tissue: Minghui63 young leaf, score: 95.434	N	N	N	N
vg0804004654	G -> T	LOC_Os08g07140-LOC_Os08g07160	intergenic_region ; MODIFIER	silent_mutation	Average:55.692; most accessible tissue: Minghui63 young leaf, score: 95.434	N	N	N	N
vg0804004654	G -> A	LOC_Os08g07140.1	upstream_gene_variant ; 3269.0bp to feature; MODIFIER	silent_mutation	Average:55.692; most accessible tissue: Minghui63 young leaf, score: 95.434	N	N	N	N
vg0804004654	G -> A	LOC_Os08g07160.1	downstream_gene_variant ; 762.0bp to feature; MODIFIER	silent_mutation	Average:55.692; most accessible tissue: Minghui63 young leaf, score: 95.434	N	N	N	N
vg0804004654	G -> A	LOC_Os08g07140-LOC_Os08g07160	intergenic_region ; MODIFIER	silent_mutation	Average:55.692; most accessible tissue: Minghui63 young leaf, score: 95.434	N	N	N	N
vg0804004654	G -> DEL	N	N	silent_mutation	Average:55.692; most accessible tissue: Minghui63 young leaf, score: 95.434	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0804004654	1.34E-06	6.67E-11	mr1002	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804004654	NA	6.24E-09	mr1002	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804004654	4.25E-06	NA	mr1035	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804004654	2.23E-06	5.73E-13	mr1182	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804004654	NA	6.65E-07	mr1182	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804004654	NA	3.53E-10	mr1282	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804004654	NA	1.09E-06	mr1330	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804004654	2.43E-06	NA	mr1626	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804004654	NA	1.27E-06	mr1626	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804004654	1.77E-06	8.21E-13	mr1650	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804004654	NA	1.56E-06	mr1650	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804004654	NA	2.69E-10	mr1658	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804004654	NA	9.42E-06	mr1658	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804004654	NA	7.20E-10	mr1002_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251