\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0804004654:

Variant ID: vg0804004654 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 4004654
Reference Allele: GAlternative Allele: T,A
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AAGGTGAATTTAATTACTTTTCCAATTAAATTAATCACTGAAATGATCTTTGAATTGTTAAAAATACTTCCAATGCTCAAATAATTTCAAGAAAAATCCT[G/T,A]
AAAATACTTGAAAACTATAAATATTTAAAACAATTATAATCAGACCATTTAATGATTAATTTAATATGTGAATAATTACTGAAATGTTGTTTGTATTATT

Reverse complement sequence

AATAATACAAACAACATTTCAGTAATTATTCACATATTAAATTAATCATTAAATGGTCTGATTATAATTGTTTTAAATATTTATAGTTTTCAAGTATTTT[C/A,T]
AGGATTTTTCTTGAAATTATTTGAGCATTGGAAGTATTTTTAACAATTCAAAGATCATTTCAGTGATTAATTTAATTGGAAAAGTAATTAAATTCACCTT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 43.40% 6.90% 23.61% 26.09% A: 0.06%
All Indica  2759 30.60% 0.10% 30.88% 38.35% NA
All Japonica  1512 73.30% 20.80% 3.97% 1.98% NA
Aus  269 11.90% 0.40% 47.21% 39.41% A: 1.12%
Indica I  595 19.70% 0.30% 50.76% 29.24% NA
Indica II  465 77.20% 0.00% 9.46% 13.33% NA
Indica III  913 13.80% 0.00% 35.71% 50.49% NA
Indica Intermediate  786 30.90% 0.30% 22.90% 45.93% NA
Temperate Japonica  767 62.10% 34.80% 1.04% 2.09% NA
Tropical Japonica  504 82.50% 5.40% 9.92% 2.18% NA
Japonica Intermediate  241 89.60% 8.30% 0.83% 1.24% NA
VI/Aromatic  96 14.60% 3.10% 60.42% 21.88% NA
Intermediate  90 55.60% 3.30% 21.11% 20.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0804004654 G -> T LOC_Os08g07140.1 upstream_gene_variant ; 3269.0bp to feature; MODIFIER silent_mutation Average:55.692; most accessible tissue: Minghui63 young leaf, score: 95.434 N N N N
vg0804004654 G -> T LOC_Os08g07160.1 downstream_gene_variant ; 762.0bp to feature; MODIFIER silent_mutation Average:55.692; most accessible tissue: Minghui63 young leaf, score: 95.434 N N N N
vg0804004654 G -> T LOC_Os08g07140-LOC_Os08g07160 intergenic_region ; MODIFIER silent_mutation Average:55.692; most accessible tissue: Minghui63 young leaf, score: 95.434 N N N N
vg0804004654 G -> A LOC_Os08g07140.1 upstream_gene_variant ; 3269.0bp to feature; MODIFIER silent_mutation Average:55.692; most accessible tissue: Minghui63 young leaf, score: 95.434 N N N N
vg0804004654 G -> A LOC_Os08g07160.1 downstream_gene_variant ; 762.0bp to feature; MODIFIER silent_mutation Average:55.692; most accessible tissue: Minghui63 young leaf, score: 95.434 N N N N
vg0804004654 G -> A LOC_Os08g07140-LOC_Os08g07160 intergenic_region ; MODIFIER silent_mutation Average:55.692; most accessible tissue: Minghui63 young leaf, score: 95.434 N N N N
vg0804004654 G -> DEL N N silent_mutation Average:55.692; most accessible tissue: Minghui63 young leaf, score: 95.434 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0804004654 1.34E-06 6.67E-11 mr1002 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804004654 NA 6.24E-09 mr1002 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804004654 4.25E-06 NA mr1035 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804004654 2.23E-06 5.73E-13 mr1182 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804004654 NA 6.65E-07 mr1182 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804004654 NA 3.53E-10 mr1282 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804004654 NA 1.09E-06 mr1330 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804004654 2.43E-06 NA mr1626 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804004654 NA 1.27E-06 mr1626 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804004654 1.77E-06 8.21E-13 mr1650 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804004654 NA 1.56E-06 mr1650 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804004654 NA 2.69E-10 mr1658 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804004654 NA 9.42E-06 mr1658 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0804004654 NA 7.20E-10 mr1002_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251