\
| Variant ID: vg0803976100 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 3976100 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.70, G: 0.30, others allele: 0.00, population size: 105. )
TTATTTTATCCTTAGCTAGGGCATCAACTATGTATATGACAAAATGATCCATATAGATGGGACACATATAAATGAACTTTAACTATAGCAATCCCACAAT[A/G]
TATATAGACACAAGGTATCATTAGAAAAAGAGAGAGGAGTAGAGATAGATAATATTATTTATTCCGCCATATGGGTAATCTATTTGCATATGGGTACCTT
AAGGTACCCATATGCAAATAGATTACCCATATGGCGGAATAAATAATATTATCTATCTCTACTCCTCTCTCTTTTTCTAATGATACCTTGTGTCTATATA[T/C]
ATTGTGGGATTGCTATAGTTAAAGTTCATTTATATGTGTCCCATCTATATGGATCATTTTGTCATATACATAGTTGATGCCCTAGCTAAGGATAAAATAA
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 67.10% | 32.60% | 0.25% | 0.00% | NA |
| All Indica | 2759 | 79.80% | 20.00% | 0.18% | 0.00% | NA |
| All Japonica | 1512 | 41.30% | 58.40% | 0.26% | 0.00% | NA |
| Aus | 269 | 81.40% | 18.60% | 0.00% | 0.00% | NA |
| Indica I | 595 | 91.30% | 8.70% | 0.00% | 0.00% | NA |
| Indica II | 465 | 28.80% | 71.00% | 0.22% | 0.00% | NA |
| Indica III | 913 | 98.50% | 1.50% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 79.50% | 20.00% | 0.51% | 0.00% | NA |
| Temperate Japonica | 767 | 62.80% | 37.00% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 18.30% | 81.50% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 21.20% | 78.00% | 0.83% | 0.00% | NA |
| VI/Aromatic | 96 | 79.20% | 20.80% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 57.80% | 38.90% | 3.33% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0803976100 | A -> G | LOC_Os08g07100.1 | intron_variant ; MODIFIER | silent_mutation | Average:27.577; most accessible tissue: Zhenshan97 young leaf, score: 41.875 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0803976100 | NA | 2.29E-06 | mr1002 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0803976100 | NA | 3.03E-07 | mr1182 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0803976100 | NA | 2.07E-08 | mr1565 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0803976100 | NA | 2.34E-07 | mr1650 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0803976100 | NA | 6.70E-08 | mr1002_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0803976100 | NA | 8.79E-09 | mr1406_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |