Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0803945806:

Variant ID: vg0803945806 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 3945806
Reference Allele: G	Alternative Allele: T
Primary Allele: T	Secondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.95, T: 0.05, others allele: 0.00, population size: 104. )

Flanking Sequence (100 bp) in Reference Genome:

TTAACTTTAAAAATATTTTACCAACAATTAGTATAAATAATATGAATTTTTATTTGCTGAAAATAATATCATTGGATTGAGATTTGAATATGTTTCATAC[G/T]
GTTATAATTTGTTGCTACAAACTTTACAGTATACGAGAAATTATAAACCAAAGATTAATTTTGAAAATCATGTCGAGTTTGATCATGGCTTATAATAGAG

Reverse complement sequence

CTCTATTATAAGCCATGATCAAACTCGACATGATTTTCAAAATTAATCTTTGGTTTATAATTTCTCGTATACTGTAAAGTTTGTAGCAACAAATTATAAC[C/A]
GTATGAAACATATTCAAATCTCAATCCAATGATATTATTTTCAGCAAATAAAAATTCATATTATTTATACTAATTGTTGGTAAAATATTTTTAAAGTTAA

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	70.90%	28.80%	0.25%	0.00%	NA
All Indica	2759	76.90%	22.80%	0.29%	0.00%	NA
All Japonica	1512	62.00%	37.90%	0.07%	0.00%	NA
Aus	269	73.20%	26.80%	0.00%	0.00%	NA
Indica I	595	42.20%	57.60%	0.17%	0.00%	NA
Indica II	465	90.10%	9.90%	0.00%	0.00%	NA
Indica III	913	87.80%	11.80%	0.33%	0.00%	NA
Indica Intermediate	786	82.60%	16.90%	0.51%	0.00%	NA
Temperate Japonica	767	42.50%	57.40%	0.13%	0.00%	NA
Tropical Japonica	504	83.50%	16.50%	0.00%	0.00%	NA
Japonica Intermediate	241	79.30%	20.70%	0.00%	0.00%	NA
VI/Aromatic	96	37.50%	59.40%	3.12%	0.00%	NA
Intermediate	90	67.80%	32.20%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0803945806	G -> T	LOC_Os08g07040.1	upstream_gene_variant ; 1010.0bp to feature; MODIFIER	silent_mutation	Average:35.73; most accessible tissue: Minghui63 root, score: 49.234	N	N	N	N
vg0803945806	G -> T	LOC_Os08g07060.1	upstream_gene_variant ; 3211.0bp to feature; MODIFIER	silent_mutation	Average:35.73; most accessible tissue: Minghui63 root, score: 49.234	N	N	N	N
vg0803945806	G -> T	LOC_Os08g07050.1	downstream_gene_variant ; 125.0bp to feature; MODIFIER	silent_mutation	Average:35.73; most accessible tissue: Minghui63 root, score: 49.234	N	N	N	N
vg0803945806	G -> T	LOC_Os08g07040-LOC_Os08g07050	intergenic_region ; MODIFIER	silent_mutation	Average:35.73; most accessible tissue: Minghui63 root, score: 49.234	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0803945806	NA	3.42E-07	mr1002	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0803945806	NA	1.17E-06	mr1347	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0803945806	NA	4.01E-08	mr1180_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0803945806	NA	1.45E-07	mr1183_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0803945806	NA	4.29E-07	mr1252_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0803945806	9.50E-07	9.49E-07	mr1367_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0803945806	NA	1.99E-07	mr1498_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0803945806	NA	4.75E-07	mr1567_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251