\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0803869823:

Variant ID: vg0803869823 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 3869823
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TCCCTCTAAACATGATACCCCCGGGCCCATATCACCGACATCGTCAATCTCCAGGATTTACCGGCCCAGTCTTCGAAGATGCTTATAGGTGTGTGTTATG[G/A]
GTGTCTGCGTTGTACCGTGTAATTAAAAAAGTTAATATCTGTGGGAATATGGTGTTGATCAACACATGGGAATATGTACTACTATTACGATTCCAAAATT

Reverse complement sequence

AATTTTGGAATCGTAATAGTAGTACATATTCCCATGTGTTGATCAACACCATATTCCCACAGATATTAACTTTTTTAATTACACGGTACAACGCAGACAC[C/T]
CATAACACACACCTATAAGCATCTTCGAAGACTGGGCCGGTAAATCCTGGAGATTGACGATGTCGGTGATATGGGCCCGGGGGTATCATGTTTAGAGGGA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 65.50% 1.30% 0.25% 32.97% NA
All Indica  2759 80.00% 2.10% 0.29% 17.62% NA
All Japonica  1512 34.10% 0.10% 0.26% 65.61% NA
Aus  269 99.30% 0.70% 0.00% 0.00% NA
Indica I  595 90.90% 0.00% 0.34% 8.74% NA
Indica II  465 32.00% 4.30% 0.00% 63.66% NA
Indica III  913 96.30% 3.20% 0.22% 0.33% NA
Indica Intermediate  786 81.20% 1.10% 0.51% 17.18% NA
Temperate Japonica  767 48.00% 0.00% 0.26% 51.76% NA
Tropical Japonica  504 18.30% 0.00% 0.20% 81.55% NA
Japonica Intermediate  241 22.80% 0.40% 0.41% 76.35% NA
VI/Aromatic  96 47.90% 0.00% 0.00% 52.08% NA
Intermediate  90 66.70% 0.00% 0.00% 33.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0803869823 G -> A LOC_Os08g06940.1 downstream_gene_variant ; 3882.0bp to feature; MODIFIER silent_mutation Average:56.559; most accessible tissue: Zhenshan97 flag leaf, score: 85.514 N N N N
vg0803869823 G -> A LOC_Os08g06940-LOC_Os08g06960 intergenic_region ; MODIFIER silent_mutation Average:56.559; most accessible tissue: Zhenshan97 flag leaf, score: 85.514 N N N N
vg0803869823 G -> DEL N N silent_mutation Average:56.559; most accessible tissue: Zhenshan97 flag leaf, score: 85.514 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0803869823 NA 2.22E-11 mr1002 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0803869823 NA 2.35E-08 mr1182 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0803869823 NA 3.18E-06 mr1282 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0803869823 NA 7.96E-08 mr1650 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0803869823 NA 1.08E-06 mr1658 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0803869823 NA 3.66E-10 mr1002_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0803869823 NA 4.67E-08 mr1010_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0803869823 NA 4.80E-06 mr1406_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0803869823 NA 1.84E-06 mr1449_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251