\
| Variant ID: vg0803869823 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 3869823 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
TCCCTCTAAACATGATACCCCCGGGCCCATATCACCGACATCGTCAATCTCCAGGATTTACCGGCCCAGTCTTCGAAGATGCTTATAGGTGTGTGTTATG[G/A]
GTGTCTGCGTTGTACCGTGTAATTAAAAAAGTTAATATCTGTGGGAATATGGTGTTGATCAACACATGGGAATATGTACTACTATTACGATTCCAAAATT
AATTTTGGAATCGTAATAGTAGTACATATTCCCATGTGTTGATCAACACCATATTCCCACAGATATTAACTTTTTTAATTACACGGTACAACGCAGACAC[C/T]
CATAACACACACCTATAAGCATCTTCGAAGACTGGGCCGGTAAATCCTGGAGATTGACGATGTCGGTGATATGGGCCCGGGGGTATCATGTTTAGAGGGA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 65.50% | 1.30% | 0.25% | 32.97% | NA |
| All Indica | 2759 | 80.00% | 2.10% | 0.29% | 17.62% | NA |
| All Japonica | 1512 | 34.10% | 0.10% | 0.26% | 65.61% | NA |
| Aus | 269 | 99.30% | 0.70% | 0.00% | 0.00% | NA |
| Indica I | 595 | 90.90% | 0.00% | 0.34% | 8.74% | NA |
| Indica II | 465 | 32.00% | 4.30% | 0.00% | 63.66% | NA |
| Indica III | 913 | 96.30% | 3.20% | 0.22% | 0.33% | NA |
| Indica Intermediate | 786 | 81.20% | 1.10% | 0.51% | 17.18% | NA |
| Temperate Japonica | 767 | 48.00% | 0.00% | 0.26% | 51.76% | NA |
| Tropical Japonica | 504 | 18.30% | 0.00% | 0.20% | 81.55% | NA |
| Japonica Intermediate | 241 | 22.80% | 0.40% | 0.41% | 76.35% | NA |
| VI/Aromatic | 96 | 47.90% | 0.00% | 0.00% | 52.08% | NA |
| Intermediate | 90 | 66.70% | 0.00% | 0.00% | 33.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0803869823 | G -> A | LOC_Os08g06940.1 | downstream_gene_variant ; 3882.0bp to feature; MODIFIER | silent_mutation | Average:56.559; most accessible tissue: Zhenshan97 flag leaf, score: 85.514 | N | N | N | N |
| vg0803869823 | G -> A | LOC_Os08g06940-LOC_Os08g06960 | intergenic_region ; MODIFIER | silent_mutation | Average:56.559; most accessible tissue: Zhenshan97 flag leaf, score: 85.514 | N | N | N | N |
| vg0803869823 | G -> DEL | N | N | silent_mutation | Average:56.559; most accessible tissue: Zhenshan97 flag leaf, score: 85.514 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0803869823 | NA | 2.22E-11 | mr1002 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0803869823 | NA | 2.35E-08 | mr1182 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0803869823 | NA | 3.18E-06 | mr1282 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0803869823 | NA | 7.96E-08 | mr1650 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0803869823 | NA | 1.08E-06 | mr1658 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0803869823 | NA | 3.66E-10 | mr1002_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0803869823 | NA | 4.67E-08 | mr1010_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0803869823 | NA | 4.80E-06 | mr1406_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0803869823 | NA | 1.84E-06 | mr1449_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |