\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0803821174:

Variant ID: vg0803821174 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 3821174
Reference Allele: CAlternative Allele: A
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CAGCATCGCCATGCGCACCGCCGCTCGCCGCCGCACTTCTTGCCGCCGCCGCCATGGATGAGGTTGCTGCGGCGGCGCATGGGGCAGACGGAAGGGTCGG[C/A]
GAGGATGGACGGCCGCACGCTCGAGCTCTGCATTTTTTCCCTTCCCTTCTCTGCTTCTCTCGTTGGCGTGGTGGAGGCGGCGAACGGTCCGTCGTCCTGG

Reverse complement sequence

CCAGGACGACGGACCGTTCGCCGCCTCCACCACGCCAACGAGAGAAGCAGAGAAGGGAAGGGAAAAAATGCAGAGCTCGAGCGTGCGGCCGTCCATCCTC[G/T]
CCGACCCTTCCGTCTGCCCCATGCGCCGCCGCAGCAACCTCATCCATGGCGGCGGCGGCAAGAAGTGCGGCGGCGAGCGGCGGTGCGCATGGCGATGCTG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 90.20% 8.30% 1.50% 0.00% NA
All Indica  2759 99.00% 0.20% 0.83% 0.00% NA
All Japonica  1512 72.60% 24.50% 2.98% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 95.70% 0.40% 3.87% 0.00% NA
Indica III  913 99.70% 0.20% 0.11% 0.00% NA
Indica Intermediate  786 99.40% 0.10% 0.51% 0.00% NA
Temperate Japonica  767 97.80% 0.50% 1.69% 0.00% NA
Tropical Japonica  504 31.70% 64.50% 3.77% 0.00% NA
Japonica Intermediate  241 77.60% 17.00% 5.39% 0.00% NA
VI/Aromatic  96 92.70% 7.30% 0.00% 0.00% NA
Intermediate  90 86.70% 10.00% 3.33% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0803821174 C -> A LOC_Os08g06840.1 upstream_gene_variant ; 1084.0bp to feature; MODIFIER silent_mutation Average:84.817; most accessible tissue: Zhenshan97 panicle, score: 89.846 N N N N
vg0803821174 C -> A LOC_Os08g06850.1 upstream_gene_variant ; 2587.0bp to feature; MODIFIER silent_mutation Average:84.817; most accessible tissue: Zhenshan97 panicle, score: 89.846 N N N N
vg0803821174 C -> A LOC_Os08g06830.1 downstream_gene_variant ; 3730.0bp to feature; MODIFIER silent_mutation Average:84.817; most accessible tissue: Zhenshan97 panicle, score: 89.846 N N N N
vg0803821174 C -> A LOC_Os08g06840-LOC_Os08g06850 intergenic_region ; MODIFIER silent_mutation Average:84.817; most accessible tissue: Zhenshan97 panicle, score: 89.846 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0803821174 C A 0.04 0.02 0.03 0.04 0.04 0.05

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0803821174 NA 2.00E-06 mr1338 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0803821174 NA 1.38E-07 mr1696 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0803821174 NA 9.89E-06 mr1798 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0803821174 NA 2.16E-10 mr1089_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0803821174 NA 4.56E-13 mr1097_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0803821174 NA 9.95E-07 mr1206_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0803821174 NA 5.85E-07 mr1250_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0803821174 NA 1.46E-09 mr1335_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0803821174 NA 6.61E-06 mr1405_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0803821174 NA 1.73E-07 mr1418_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0803821174 NA 6.27E-07 mr1419_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0803821174 NA 6.06E-07 mr1420_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0803821174 NA 8.42E-07 mr1423_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0803821174 NA 3.96E-06 mr1470_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0803821174 NA 1.12E-07 mr1488_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0803821174 NA 2.20E-09 mr1506_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0803821174 NA 8.77E-06 mr1556_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0803821174 NA 1.55E-06 mr1596_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0803821174 NA 9.87E-07 mr1786_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0803821174 NA 2.54E-08 mr1800_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251