\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0803676578:

Variant ID: vg0803676578 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 3676578
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TCATTGTTAAATATACTTTTATGTATACATATAATTTTACATATTTCACAAAAGTTTTTGAATAAGACGAACGGTCAAACATGTTTAAAAAAGTCAACGG[C/T]
GTCAAACCATTAGGGAAGGAGGAAATAAGTCATAATAAGGTTAATTGGTTGTAGTATAGTTAAGGTGTAATTATATTACAATTATACTATATTTATATTT

Reverse complement sequence

AAATATAAATATAGTATAATTGTAATATAATTACACCTTAACTATACTACAACCAATTAACCTTATTATGACTTATTTCCTCCTTCCCTAATGGTTTGAC[G/A]
CCGTTGACTTTTTTAAACATGTTTGACCGTTCGTCTTATTCAAAAACTTTTGTGAAATATGTAAAATTATATGTATACATAAAAGTATATTTAACAATGA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 96.20% 3.80% 0.04% 0.00% NA
All Indica  2759 98.00% 1.90% 0.07% 0.00% NA
All Japonica  1512 99.90% 0.10% 0.00% 0.00% NA
Aus  269 80.70% 19.30% 0.00% 0.00% NA
Indica I  595 99.50% 0.50% 0.00% 0.00% NA
Indica II  465 98.50% 1.50% 0.00% 0.00% NA
Indica III  913 98.80% 1.10% 0.11% 0.00% NA
Indica Intermediate  786 95.80% 4.10% 0.13% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 99.80% 0.20% 0.00% 0.00% NA
Japonica Intermediate  241 99.60% 0.40% 0.00% 0.00% NA
VI/Aromatic  96 29.20% 70.80% 0.00% 0.00% NA
Intermediate  90 95.60% 4.40% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0803676578 C -> T LOC_Os08g06490.1 upstream_gene_variant ; 453.0bp to feature; MODIFIER silent_mutation Average:60.44; most accessible tissue: Minghui63 flower, score: 81.118 N N N N
vg0803676578 C -> T LOC_Os08g06500.1 upstream_gene_variant ; 4347.0bp to feature; MODIFIER silent_mutation Average:60.44; most accessible tissue: Minghui63 flower, score: 81.118 N N N N
vg0803676578 C -> T LOC_Os08g06490.2 upstream_gene_variant ; 453.0bp to feature; MODIFIER silent_mutation Average:60.44; most accessible tissue: Minghui63 flower, score: 81.118 N N N N
vg0803676578 C -> T LOC_Os08g06480.1 downstream_gene_variant ; 765.0bp to feature; MODIFIER silent_mutation Average:60.44; most accessible tissue: Minghui63 flower, score: 81.118 N N N N
vg0803676578 C -> T LOC_Os08g06480-LOC_Os08g06490 intergenic_region ; MODIFIER silent_mutation Average:60.44; most accessible tissue: Minghui63 flower, score: 81.118 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0803676578 NA 3.50E-06 mr1201 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0803676578 7.67E-07 6.53E-08 mr1201_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0803676578 1.56E-06 3.71E-08 mr1219_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251