\
| Variant ID: vg0803676578 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 3676578 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
TCATTGTTAAATATACTTTTATGTATACATATAATTTTACATATTTCACAAAAGTTTTTGAATAAGACGAACGGTCAAACATGTTTAAAAAAGTCAACGG[C/T]
GTCAAACCATTAGGGAAGGAGGAAATAAGTCATAATAAGGTTAATTGGTTGTAGTATAGTTAAGGTGTAATTATATTACAATTATACTATATTTATATTT
AAATATAAATATAGTATAATTGTAATATAATTACACCTTAACTATACTACAACCAATTAACCTTATTATGACTTATTTCCTCCTTCCCTAATGGTTTGAC[G/A]
CCGTTGACTTTTTTAAACATGTTTGACCGTTCGTCTTATTCAAAAACTTTTGTGAAATATGTAAAATTATATGTATACATAAAAGTATATTTAACAATGA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 96.20% | 3.80% | 0.04% | 0.00% | NA |
| All Indica | 2759 | 98.00% | 1.90% | 0.07% | 0.00% | NA |
| All Japonica | 1512 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Aus | 269 | 80.70% | 19.30% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.50% | 0.50% | 0.00% | 0.00% | NA |
| Indica II | 465 | 98.50% | 1.50% | 0.00% | 0.00% | NA |
| Indica III | 913 | 98.80% | 1.10% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 95.80% | 4.10% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 29.20% | 70.80% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 95.60% | 4.40% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0803676578 | C -> T | LOC_Os08g06490.1 | upstream_gene_variant ; 453.0bp to feature; MODIFIER | silent_mutation | Average:60.44; most accessible tissue: Minghui63 flower, score: 81.118 | N | N | N | N |
| vg0803676578 | C -> T | LOC_Os08g06500.1 | upstream_gene_variant ; 4347.0bp to feature; MODIFIER | silent_mutation | Average:60.44; most accessible tissue: Minghui63 flower, score: 81.118 | N | N | N | N |
| vg0803676578 | C -> T | LOC_Os08g06490.2 | upstream_gene_variant ; 453.0bp to feature; MODIFIER | silent_mutation | Average:60.44; most accessible tissue: Minghui63 flower, score: 81.118 | N | N | N | N |
| vg0803676578 | C -> T | LOC_Os08g06480.1 | downstream_gene_variant ; 765.0bp to feature; MODIFIER | silent_mutation | Average:60.44; most accessible tissue: Minghui63 flower, score: 81.118 | N | N | N | N |
| vg0803676578 | C -> T | LOC_Os08g06480-LOC_Os08g06490 | intergenic_region ; MODIFIER | silent_mutation | Average:60.44; most accessible tissue: Minghui63 flower, score: 81.118 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0803676578 | NA | 3.50E-06 | mr1201 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0803676578 | 7.67E-07 | 6.53E-08 | mr1201_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0803676578 | 1.56E-06 | 3.71E-08 | mr1219_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |