Variant ID: vg0803653778 (JBrowse) | Variation Type: SNP |
Chromosome: chr08 | Position: 3653778 |
Reference Allele: C | Alternative Allele: A |
Primary Allele: C | Secondary Allele: A |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.86, A: 0.14, others allele: 0.00, population size: 101. )
ACTCGTAAAGGAAATCGTTTTGGACAGGGACACGGCCTCTAAGACACAACTTTGACTTTTTTTTCTATAGAAATATTTGTTGAAAAGTAATATATGTATA[C/A]
TTTTATGAAAGTATTTTTCAAGACAAATCTATCCATATATTCTTACATTTTAAAACTCAACAATTTGAGAGTTATTTATGATTTATATTCTCAAGGTTTG
CAAACCTTGAGAATATAAATCATAAATAACTCTCAAATTGTTGAGTTTTAAAATGTAAGAATATATGGATAGATTTGTCTTGAAAAATACTTTCATAAAA[G/T]
TATACATATATTACTTTTCAACAAATATTTCTATAGAAAAAAAAGTCAAAGTTGTGTCTTAGAGGCCGTGTCCCTGTCCAAAACGATTTCCTTTACGAGT
Populations | Population Size | Frequency of C(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 67.70% | 32.20% | 0.15% | 0.00% | NA |
All Indica | 2759 | 86.60% | 13.30% | 0.11% | 0.00% | NA |
All Japonica | 1512 | 25.70% | 74.10% | 0.20% | 0.00% | NA |
Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Indica I | 595 | 92.40% | 7.60% | 0.00% | 0.00% | NA |
Indica II | 465 | 51.60% | 48.20% | 0.22% | 0.00% | NA |
Indica III | 913 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
Indica Intermediate | 786 | 87.40% | 12.30% | 0.25% | 0.00% | NA |
Temperate Japonica | 767 | 39.20% | 60.60% | 0.13% | 0.00% | NA |
Tropical Japonica | 504 | 13.70% | 86.30% | 0.00% | 0.00% | NA |
Japonica Intermediate | 241 | 7.90% | 91.30% | 0.83% | 0.00% | NA |
VI/Aromatic | 96 | 91.70% | 8.30% | 0.00% | 0.00% | NA |
Intermediate | 90 | 71.10% | 27.80% | 1.11% | 0.00% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg0803653778 | C -> A | LOC_Os08g06478.1 | downstream_gene_variant ; 3497.0bp to feature; MODIFIER | silent_mutation | Average:70.603; most accessible tissue: Zhenshan97 flag leaf, score: 82.703 | N | N | N | N |
vg0803653778 | C -> A | LOC_Os08g06474-LOC_Os08g06478 | intergenic_region ; MODIFIER | silent_mutation | Average:70.603; most accessible tissue: Zhenshan97 flag leaf, score: 82.703 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg0803653778 | NA | 3.50E-09 | mr1002 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0803653778 | 5.56E-06 | NA | mr1182 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0803653778 | 9.28E-09 | 9.35E-13 | mr1182 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0803653778 | 7.14E-06 | NA | mr1282 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0803653778 | 7.63E-08 | 4.73E-11 | mr1282 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0803653778 | 1.52E-08 | 2.79E-11 | mr1650 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0803653778 | 1.74E-07 | 2.73E-10 | mr1658 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0803653778 | NA | 1.74E-07 | mr1010_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0803653778 | NA | 1.47E-09 | mr1182_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0803653778 | NA | 1.23E-08 | mr1282_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China
Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/