Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0803653778:

Variant ID: vg0803653778 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 3653778
Reference Allele: C	Alternative Allele: A
Primary Allele: C	Secondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.86, A: 0.14, others allele: 0.00, population size: 101. )

Flanking Sequence (100 bp) in Reference Genome:

ACTCGTAAAGGAAATCGTTTTGGACAGGGACACGGCCTCTAAGACACAACTTTGACTTTTTTTTCTATAGAAATATTTGTTGAAAAGTAATATATGTATA[C/A]
TTTTATGAAAGTATTTTTCAAGACAAATCTATCCATATATTCTTACATTTTAAAACTCAACAATTTGAGAGTTATTTATGATTTATATTCTCAAGGTTTG

Reverse complement sequence

CAAACCTTGAGAATATAAATCATAAATAACTCTCAAATTGTTGAGTTTTAAAATGTAAGAATATATGGATAGATTTGTCTTGAAAAATACTTTCATAAAA[G/T]
TATACATATATTACTTTTCAACAAATATTTCTATAGAAAAAAAAGTCAAAGTTGTGTCTTAGAGGCCGTGTCCCTGTCCAAAACGATTTCCTTTACGAGT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	67.70%	32.20%	0.15%	0.00%	NA
All Indica	2759	86.60%	13.30%	0.11%	0.00%	NA
All Japonica	1512	25.70%	74.10%	0.20%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	92.40%	7.60%	0.00%	0.00%	NA
Indica II	465	51.60%	48.20%	0.22%	0.00%	NA
Indica III	913	99.90%	0.10%	0.00%	0.00%	NA
Indica Intermediate	786	87.40%	12.30%	0.25%	0.00%	NA
Temperate Japonica	767	39.20%	60.60%	0.13%	0.00%	NA
Tropical Japonica	504	13.70%	86.30%	0.00%	0.00%	NA
Japonica Intermediate	241	7.90%	91.30%	0.83%	0.00%	NA
VI/Aromatic	96	91.70%	8.30%	0.00%	0.00%	NA
Intermediate	90	71.10%	27.80%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0803653778	C -> A	LOC_Os08g06478.1	downstream_gene_variant ; 3497.0bp to feature; MODIFIER	silent_mutation	Average:70.603; most accessible tissue: Zhenshan97 flag leaf, score: 82.703	N	N	N	N
vg0803653778	C -> A	LOC_Os08g06474-LOC_Os08g06478	intergenic_region ; MODIFIER	silent_mutation	Average:70.603; most accessible tissue: Zhenshan97 flag leaf, score: 82.703	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0803653778	NA	3.50E-09	mr1002	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0803653778	5.56E-06	NA	mr1182	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0803653778	9.28E-09	9.35E-13	mr1182	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0803653778	7.14E-06	NA	mr1282	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0803653778	7.63E-08	4.73E-11	mr1282	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0803653778	1.52E-08	2.79E-11	mr1650	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0803653778	1.74E-07	2.73E-10	mr1658	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0803653778	NA	1.74E-07	mr1010_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0803653778	NA	1.47E-09	mr1182_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0803653778	NA	1.23E-08	mr1282_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0803653778	NA	3.70E-06	mr1558_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251