\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0803653778:

Variant ID: vg0803653778 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 3653778
Reference Allele: CAlternative Allele: A
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.86, A: 0.14, others allele: 0.00, population size: 101. )

Flanking Sequence (100 bp) in Reference Genome:


ACTCGTAAAGGAAATCGTTTTGGACAGGGACACGGCCTCTAAGACACAACTTTGACTTTTTTTTCTATAGAAATATTTGTTGAAAAGTAATATATGTATA[C/A]
TTTTATGAAAGTATTTTTCAAGACAAATCTATCCATATATTCTTACATTTTAAAACTCAACAATTTGAGAGTTATTTATGATTTATATTCTCAAGGTTTG

Reverse complement sequence

CAAACCTTGAGAATATAAATCATAAATAACTCTCAAATTGTTGAGTTTTAAAATGTAAGAATATATGGATAGATTTGTCTTGAAAAATACTTTCATAAAA[G/T]
TATACATATATTACTTTTCAACAAATATTTCTATAGAAAAAAAAGTCAAAGTTGTGTCTTAGAGGCCGTGTCCCTGTCCAAAACGATTTCCTTTACGAGT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 67.70% 32.20% 0.15% 0.00% NA
All Indica  2759 86.60% 13.30% 0.11% 0.00% NA
All Japonica  1512 25.70% 74.10% 0.20% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 92.40% 7.60% 0.00% 0.00% NA
Indica II  465 51.60% 48.20% 0.22% 0.00% NA
Indica III  913 99.90% 0.10% 0.00% 0.00% NA
Indica Intermediate  786 87.40% 12.30% 0.25% 0.00% NA
Temperate Japonica  767 39.20% 60.60% 0.13% 0.00% NA
Tropical Japonica  504 13.70% 86.30% 0.00% 0.00% NA
Japonica Intermediate  241 7.90% 91.30% 0.83% 0.00% NA
VI/Aromatic  96 91.70% 8.30% 0.00% 0.00% NA
Intermediate  90 71.10% 27.80% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0803653778 C -> A LOC_Os08g06478.1 downstream_gene_variant ; 3497.0bp to feature; MODIFIER silent_mutation Average:70.603; most accessible tissue: Zhenshan97 flag leaf, score: 82.703 N N N N
vg0803653778 C -> A LOC_Os08g06474-LOC_Os08g06478 intergenic_region ; MODIFIER silent_mutation Average:70.603; most accessible tissue: Zhenshan97 flag leaf, score: 82.703 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0803653778 NA 3.50E-09 mr1002 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0803653778 5.56E-06 NA mr1182 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0803653778 9.28E-09 9.35E-13 mr1182 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0803653778 7.14E-06 NA mr1282 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0803653778 7.63E-08 4.73E-11 mr1282 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0803653778 1.52E-08 2.79E-11 mr1650 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0803653778 1.74E-07 2.73E-10 mr1658 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0803653778 NA 1.74E-07 mr1010_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0803653778 NA 1.47E-09 mr1182_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0803653778 NA 1.23E-08 mr1282_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0803653778 NA 3.70E-06 mr1558_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251