\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0803543650:

Variant ID: vg0803543650 (JBrowse)Variation Type: INDEL
Chromosome: chr08Position: 3543650
Reference Allele: TAlternative Allele: A,TA
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.69, A: 0.31, others allele: 0.00, population size: 78. )

Flanking Sequence (100 bp) in Reference Genome:


TGTGTATGAAAACGGCTGATTAGCCATGTAAAAAGCGTGATTAGTGTATGATAAATTGTGTATTAATTATTAAAAACTTAAAATTGGTATATATTTTTTT[T/A,TA]
AAAAAACAACTTCTATATAAAAATTTCGCACGGAACACAAACAGTTTAAAAAAACGTGCCAGCGAAAAAGGATAAAGTACCTAAGGTGAACGTAGTTTTG

Reverse complement sequence

CAAAACTACGTTCACCTTAGGTACTTTATCCTTTTTCGCTGGCACGTTTTTTTAAACTGTTTGTGTTCCGTGCGAAATTTTTATATAGAAGTTGTTTTTT[A/T,TA]
AAAAAAATATATACCAATTTTAAGTTTTTAATAATTAATACACAATTTATCATACACTAATCACGCTTTTTACATGGCTAATCAGCCGTTTTCATACACA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 66.60% 29.00% 0.40% 0.00% TA: 4.00%
All Indica  2759 68.80% 26.00% 0.36% 0.00% TA: 4.86%
All Japonica  1512 58.40% 40.50% 0.26% 0.00% TA: 0.86%
Aus  269 97.40% 1.50% 0.37% 0.00% TA: 0.74%
Indica I  595 89.60% 9.90% 0.00% 0.00% TA: 0.50%
Indica II  465 48.60% 49.90% 0.86% 0.00% TA: 0.65%
Indica III  913 65.20% 24.50% 0.22% 0.00% TA: 10.08%
Indica Intermediate  786 69.20% 25.70% 0.51% 0.00% TA: 4.58%
Temperate Japonica  767 82.70% 16.80% 0.52% 0.00% NA
Tropical Japonica  504 21.60% 76.20% 0.00% 0.00% TA: 2.18%
Japonica Intermediate  241 58.10% 41.10% 0.00% 0.00% TA: 0.83%
VI/Aromatic  96 52.10% 8.30% 1.04% 0.00% TA: 38.54%
Intermediate  90 58.90% 34.40% 3.33% 0.00% TA: 3.33%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0803543650 T -> TA LOC_Os08g06380.1 downstream_gene_variant ; 512.0bp to feature; MODIFIER silent_mutation Average:85.112; most accessible tissue: Minghui63 young leaf, score: 94.965 N N N N
vg0803543650 T -> TA LOC_Os08g06380.2 downstream_gene_variant ; 512.0bp to feature; MODIFIER silent_mutation Average:85.112; most accessible tissue: Minghui63 young leaf, score: 94.965 N N N N
vg0803543650 T -> TA LOC_Os08g06370-LOC_Os08g06380 intergenic_region ; MODIFIER silent_mutation Average:85.112; most accessible tissue: Minghui63 young leaf, score: 94.965 N N N N
vg0803543650 T -> A LOC_Os08g06380.1 downstream_gene_variant ; 513.0bp to feature; MODIFIER silent_mutation Average:85.112; most accessible tissue: Minghui63 young leaf, score: 94.965 N N N N
vg0803543650 T -> A LOC_Os08g06380.2 downstream_gene_variant ; 513.0bp to feature; MODIFIER silent_mutation Average:85.112; most accessible tissue: Minghui63 young leaf, score: 94.965 N N N N
vg0803543650 T -> A LOC_Os08g06370-LOC_Os08g06380 intergenic_region ; MODIFIER silent_mutation Average:85.112; most accessible tissue: Minghui63 young leaf, score: 94.965 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0803543650 T A -0.02 -0.01 -0.01 0.0 -0.01 -0.01
vg0803543650 T TA -0.03 0.04 -0.03 -0.09 -0.06 -0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0803543650 NA 5.59E-07 mr1182 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0803543650 2.91E-06 2.91E-06 mr1261 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0803543650 NA 6.21E-10 mr1565 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0803543650 NA 8.73E-06 mr1650 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0803543650 NA 5.27E-06 mr1449_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0803543650 NA 6.68E-07 mr1536_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0803543650 NA 1.10E-07 mr1558_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251