\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0803532222:

Variant ID: vg0803532222 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 3532222
Reference Allele: GAlternative Allele: T
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 76. )

Flanking Sequence (100 bp) in Reference Genome:


CATTAGATTCGTCTCGCAAATTAGTCCAAGATTATGGATGGGTTTTATTAATAGTCTACGTTTAATATTTATAATTAATTTTTAAACATCCGATGTGATA[G/T]
GGACTTAAAAGTTCTAGTACTAGCTACCATCACTCTTGTGAGCCTCCTCCTTCAGTCAAACCATCCCTTTGTATGTAGTAAGAGAAAGAAATATGGAGTA

Reverse complement sequence

TACTCCATATTTCTTTCTCTTACTACATACAAAGGGATGGTTTGACTGAAGGAGGAGGCTCACAAGAGTGATGGTAGCTAGTACTAGAACTTTTAAGTCC[C/A]
TATCACATCGGATGTTTAAAAATTAATTATAAATATTAAACGTAGACTATTAATAAAACCCATCCATAATCTTGGACTAATTTGCGAGACGAATCTAATG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 23.10% 6.50% 10.81% 59.61% NA
All Indica  2759 3.30% 0.20% 13.52% 83.00% NA
All Japonica  1512 65.50% 19.00% 8.40% 7.08% NA
Aus  269 0.40% 0.00% 0.00% 99.63% NA
Indica I  595 1.20% 0.00% 3.87% 94.96% NA
Indica II  465 11.60% 0.20% 24.95% 63.23% NA
Indica III  913 0.10% 0.10% 20.48% 79.30% NA
Indica Intermediate  786 3.60% 0.50% 5.98% 89.95% NA
Temperate Japonica  767 89.20% 3.10% 6.13% 1.56% NA
Tropical Japonica  504 27.00% 44.80% 10.91% 17.26% NA
Japonica Intermediate  241 70.50% 15.80% 10.37% 3.32% NA
VI/Aromatic  96 1.00% 0.00% 3.12% 95.83% NA
Intermediate  90 11.10% 13.30% 8.89% 66.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0803532222 G -> T LOC_Os08g06370.1 intron_variant ; MODIFIER silent_mutation Average:44.659; most accessible tissue: Zhenshan97 panicle, score: 83.41 N N N N
vg0803532222 G -> DEL N N silent_mutation Average:44.659; most accessible tissue: Zhenshan97 panicle, score: 83.41 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0803532222 G T -0.06 -0.05 -0.03 0.01 -0.08 -0.05

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0803532222 NA 1.77E-07 mr1277 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0803532222 NA 1.53E-07 mr1668 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0803532222 NA 1.78E-10 mr1379_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0803532222 NA 6.84E-07 mr1379_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0803532222 NA 2.31E-08 mr1449_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0803532222 NA 9.63E-06 mr1449_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0803532222 4.83E-06 4.82E-06 mr1487_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0803532222 NA 1.76E-07 mr1551_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0803532222 NA 8.94E-07 mr1557_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0803532222 NA 2.85E-06 mr1559_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0803532222 NA 9.24E-06 mr1562_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0803532222 NA 6.93E-06 mr1575_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0803532222 NA 2.43E-06 mr1606_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0803532222 NA 8.34E-06 mr1707_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0803532222 NA 1.66E-06 mr1728_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0803532222 NA 4.83E-07 mr1819_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0803532222 2.44E-07 1.94E-08 mr1849_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0803532222 3.30E-06 9.58E-08 mr1849_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0803532222 NA 2.96E-07 mr1873_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0803532222 NA 6.91E-10 mr1905_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0803532222 2.83E-06 NA mr1916_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0803532222 NA 1.05E-11 mr1916_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0803532222 NA 2.54E-09 mr1942_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251