\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0803470128:

Variant ID: vg0803470128 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 3470128
Reference Allele: AAlternative Allele: G,C
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.70, A: 0.30, C: 0.00, others allele: 0.00, population size: 222. )

Flanking Sequence (100 bp) in Reference Genome:


ATAGATAGAAAATTTTGGCAAGAGTAAGATATATACTATGATGAATCGAGGCTTCATTTTCGTTGCGACTAGGTCAAAATTAAATATATTAGTTGTAGCT[A/G,C]
TCAAACTAAGTTAATCATTTGCTAATGATAACCGCGCCATGGCTATAAACCAAAAATGTCCGATCATAAGATGGGGATGATTTCATCATGTTTCAACATC

Reverse complement sequence

GATGTTGAAACATGATGAAATCATCCCCATCTTATGATCGGACATTTTTGGTTTATAGCCATGGCGCGGTTATCATTAGCAAATGATTAACTTAGTTTGA[T/C,G]
AGCTACAACTAATATATTTAATTTTGACCTAGTCGCAACGAAAATGAAGCCTCGATTCATCATAGTATATATCTTACTCTTGCCAAAATTTTCTATCTAT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 55.50% 44.10% 0.08% 0.23% C: 0.06%
All Indica  2759 27.70% 71.90% 0.14% 0.29% NA
All Japonica  1512 95.90% 4.00% 0.00% 0.00% C: 0.07%
Aus  269 97.80% 1.90% 0.00% 0.37% NA
Indica I  595 10.30% 89.60% 0.00% 0.17% NA
Indica II  465 64.30% 34.80% 0.00% 0.86% NA
Indica III  913 17.10% 82.80% 0.11% 0.00% NA
Indica Intermediate  786 31.40% 67.80% 0.38% 0.38% NA
Temperate Japonica  767 99.70% 0.30% 0.00% 0.00% NA
Tropical Japonica  504 88.90% 10.90% 0.00% 0.00% C: 0.20%
Japonica Intermediate  241 98.30% 1.70% 0.00% 0.00% NA
VI/Aromatic  96 95.80% 4.20% 0.00% 0.00% NA
Intermediate  90 60.00% 35.60% 0.00% 2.22% C: 2.22%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0803470128 A -> G LOC_Os08g06300.1 upstream_gene_variant ; 3759.0bp to feature; MODIFIER silent_mutation Average:84.653; most accessible tissue: Minghui63 flag leaf, score: 97.701 N N N N
vg0803470128 A -> G LOC_Os08g06290.1 downstream_gene_variant ; 3826.0bp to feature; MODIFIER silent_mutation Average:84.653; most accessible tissue: Minghui63 flag leaf, score: 97.701 N N N N
vg0803470128 A -> G LOC_Os08g06290-LOC_Os08g06300 intergenic_region ; MODIFIER silent_mutation Average:84.653; most accessible tissue: Minghui63 flag leaf, score: 97.701 N N N N
vg0803470128 A -> C LOC_Os08g06300.1 upstream_gene_variant ; 3759.0bp to feature; MODIFIER silent_mutation Average:84.653; most accessible tissue: Minghui63 flag leaf, score: 97.701 N N N N
vg0803470128 A -> C LOC_Os08g06290.1 downstream_gene_variant ; 3826.0bp to feature; MODIFIER silent_mutation Average:84.653; most accessible tissue: Minghui63 flag leaf, score: 97.701 N N N N
vg0803470128 A -> C LOC_Os08g06290-LOC_Os08g06300 intergenic_region ; MODIFIER silent_mutation Average:84.653; most accessible tissue: Minghui63 flag leaf, score: 97.701 N N N N
vg0803470128 A -> DEL N N silent_mutation Average:84.653; most accessible tissue: Minghui63 flag leaf, score: 97.701 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0803470128 A C -0.58 -0.31 -0.26 -0.01 -0.16 -0.12
vg0803470128 A G 0.11 -0.07 -0.04 0.01 -0.01 -0.03

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0803470128 NA 1.76E-18 mr1077 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0803470128 NA 4.64E-06 mr1114 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0803470128 NA 1.13E-06 mr1321 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0803470128 NA 8.84E-10 mr1565 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0803470128 NA 5.96E-07 mr1739 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0803470128 NA 4.74E-08 mr1739 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0803470128 8.68E-06 2.02E-12 mr1827 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0803470128 NA 2.89E-07 mr1836 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0803470128 NA 5.59E-12 mr1914 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0803470128 NA 7.92E-10 mr1927 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0803470128 NA 2.61E-09 mr1739_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251