\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0803457136:

Variant ID: vg0803457136 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 3457136
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GTTATGTTTACGACTGGAGCTACACGCTTGAAGTTGGTTATTGTGTTCTTGTTCTTGCTAGCTATACAATATTTGATGGTTTTTTTTAGTGGAAAAATTT[T/C]
AGATATAACTATAGTATAATTTATGTGTATAATGGATAAAGTGAGCGCGGCCGGCTGGCTTGTCCATCCTACAATGTTCAACTCCCAACTCTCGTGAGCG

Reverse complement sequence

CGCTCACGAGAGTTGGGAGTTGAACATTGTAGGATGGACAAGCCAGCCGGCCGCGCTCACTTTATCCATTATACACATAAATTATACTATAGTTATATCT[A/G]
AAATTTTTCCACTAAAAAAAACCATCAAATATTGTATAGCTAGCAAGAACAAGAACACAATAACCAACTTCAAGCGTGTAGCTCCAGTCGTAAACATAAC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 87.50% 12.40% 0.11% 0.00% NA
All Indica  2759 99.80% 0.20% 0.04% 0.00% NA
All Japonica  1512 61.70% 38.00% 0.26% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 99.10% 0.60% 0.22% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 99.70% 0.30% 0.00% 0.00% NA
Temperate Japonica  767 39.20% 60.20% 0.52% 0.00% NA
Tropical Japonica  504 90.10% 9.90% 0.00% 0.00% NA
Japonica Intermediate  241 73.90% 26.10% 0.00% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 93.30% 6.70% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0803457136 T -> C LOC_Os08g06280.1 downstream_gene_variant ; 3574.0bp to feature; MODIFIER silent_mutation Average:42.701; most accessible tissue: Callus, score: 61.109 N N N N
vg0803457136 T -> C LOC_Os08g06280.2 downstream_gene_variant ; 3574.0bp to feature; MODIFIER silent_mutation Average:42.701; most accessible tissue: Callus, score: 61.109 N N N N
vg0803457136 T -> C LOC_Os08g06280.4 downstream_gene_variant ; 3574.0bp to feature; MODIFIER silent_mutation Average:42.701; most accessible tissue: Callus, score: 61.109 N N N N
vg0803457136 T -> C LOC_Os08g06280.7 downstream_gene_variant ; 3574.0bp to feature; MODIFIER silent_mutation Average:42.701; most accessible tissue: Callus, score: 61.109 N N N N
vg0803457136 T -> C LOC_Os08g06280.3 downstream_gene_variant ; 3574.0bp to feature; MODIFIER silent_mutation Average:42.701; most accessible tissue: Callus, score: 61.109 N N N N
vg0803457136 T -> C LOC_Os08g06280.9 downstream_gene_variant ; 3574.0bp to feature; MODIFIER silent_mutation Average:42.701; most accessible tissue: Callus, score: 61.109 N N N N
vg0803457136 T -> C LOC_Os08g06280.8 downstream_gene_variant ; 3574.0bp to feature; MODIFIER silent_mutation Average:42.701; most accessible tissue: Callus, score: 61.109 N N N N
vg0803457136 T -> C LOC_Os08g06270-LOC_Os08g06280 intergenic_region ; MODIFIER silent_mutation Average:42.701; most accessible tissue: Callus, score: 61.109 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0803457136 NA 3.13E-11 Heading_date All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0803457136 NA 2.32E-10 Heading_date Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0803457136 NA 7.15E-08 mr1002 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0803457136 NA 1.63E-07 mr1002 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0803457136 NA 1.38E-06 mr1013 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0803457136 NA 4.04E-13 mr1031 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0803457136 NA 3.68E-08 mr1031 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0803457136 NA 2.39E-06 mr1034 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0803457136 NA 1.05E-06 mr1056 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0803457136 3.35E-06 4.66E-24 mr1163 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0803457136 NA 3.24E-10 mr1163 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0803457136 NA 8.74E-06 mr1180 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0803457136 NA 1.93E-06 mr1880 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0803457136 NA 2.40E-13 mr1002_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0803457136 NA 9.59E-11 mr1002_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0803457136 NA 2.25E-21 mr1010_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0803457136 NA 2.31E-09 mr1010_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0803457136 NA 1.26E-10 mr1011_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0803457136 NA 5.05E-07 mr1011_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0803457136 NA 3.28E-07 mr1013_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0803457136 NA 1.93E-14 mr1031_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0803457136 NA 3.15E-08 mr1031_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0803457136 NA 1.47E-06 mr1359_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0803457136 NA 9.31E-08 mr1449_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0803457136 NA 9.03E-08 mr1794_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251