Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0803457136:

Variant ID: vg0803457136 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 3457136
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GTTATGTTTACGACTGGAGCTACACGCTTGAAGTTGGTTATTGTGTTCTTGTTCTTGCTAGCTATACAATATTTGATGGTTTTTTTTAGTGGAAAAATTT[T/C]
AGATATAACTATAGTATAATTTATGTGTATAATGGATAAAGTGAGCGCGGCCGGCTGGCTTGTCCATCCTACAATGTTCAACTCCCAACTCTCGTGAGCG

Reverse complement sequence

CGCTCACGAGAGTTGGGAGTTGAACATTGTAGGATGGACAAGCCAGCCGGCCGCGCTCACTTTATCCATTATACACATAAATTATACTATAGTTATATCT[A/G]
AAATTTTTCCACTAAAAAAAACCATCAAATATTGTATAGCTAGCAAGAACAAGAACACAATAACCAACTTCAAGCGTGTAGCTCCAGTCGTAAACATAAC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	87.50%	12.40%	0.11%	0.00%	NA
All Indica	2759	99.80%	0.20%	0.04%	0.00%	NA
All Japonica	1512	61.70%	38.00%	0.26%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	99.10%	0.60%	0.22%	0.00%	NA
Indica III	913	100.00%	0.00%	0.00%	0.00%	NA
Indica Intermediate	786	99.70%	0.30%	0.00%	0.00%	NA
Temperate Japonica	767	39.20%	60.20%	0.52%	0.00%	NA
Tropical Japonica	504	90.10%	9.90%	0.00%	0.00%	NA
Japonica Intermediate	241	73.90%	26.10%	0.00%	0.00%	NA
VI/Aromatic	96	99.00%	1.00%	0.00%	0.00%	NA
Intermediate	90	93.30%	6.70%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0803457136	T -> C	LOC_Os08g06280.1	downstream_gene_variant ; 3574.0bp to feature; MODIFIER	silent_mutation	Average:42.701; most accessible tissue: Callus, score: 61.109	N	N	N	N
vg0803457136	T -> C	LOC_Os08g06280.2	downstream_gene_variant ; 3574.0bp to feature; MODIFIER	silent_mutation	Average:42.701; most accessible tissue: Callus, score: 61.109	N	N	N	N
vg0803457136	T -> C	LOC_Os08g06280.4	downstream_gene_variant ; 3574.0bp to feature; MODIFIER	silent_mutation	Average:42.701; most accessible tissue: Callus, score: 61.109	N	N	N	N
vg0803457136	T -> C	LOC_Os08g06280.7	downstream_gene_variant ; 3574.0bp to feature; MODIFIER	silent_mutation	Average:42.701; most accessible tissue: Callus, score: 61.109	N	N	N	N
vg0803457136	T -> C	LOC_Os08g06280.3	downstream_gene_variant ; 3574.0bp to feature; MODIFIER	silent_mutation	Average:42.701; most accessible tissue: Callus, score: 61.109	N	N	N	N
vg0803457136	T -> C	LOC_Os08g06280.9	downstream_gene_variant ; 3574.0bp to feature; MODIFIER	silent_mutation	Average:42.701; most accessible tissue: Callus, score: 61.109	N	N	N	N
vg0803457136	T -> C	LOC_Os08g06280.8	downstream_gene_variant ; 3574.0bp to feature; MODIFIER	silent_mutation	Average:42.701; most accessible tissue: Callus, score: 61.109	N	N	N	N
vg0803457136	T -> C	LOC_Os08g06270-LOC_Os08g06280	intergenic_region ; MODIFIER	silent_mutation	Average:42.701; most accessible tissue: Callus, score: 61.109	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0803457136	NA	3.13E-11	Heading_date	All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0803457136	NA	2.32E-10	Heading_date	Jap_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0803457136	NA	7.15E-08	mr1002	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0803457136	NA	1.63E-07	mr1002	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0803457136	NA	1.38E-06	mr1013	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0803457136	NA	4.04E-13	mr1031	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0803457136	NA	3.68E-08	mr1031	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0803457136	NA	2.39E-06	mr1034	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0803457136	NA	1.05E-06	mr1056	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0803457136	3.35E-06	4.66E-24	mr1163	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0803457136	NA	3.24E-10	mr1163	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0803457136	NA	8.74E-06	mr1180	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0803457136	NA	1.93E-06	mr1880	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0803457136	NA	2.40E-13	mr1002_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0803457136	NA	9.59E-11	mr1002_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0803457136	NA	2.25E-21	mr1010_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0803457136	NA	2.31E-09	mr1010_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0803457136	NA	1.26E-10	mr1011_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0803457136	NA	5.05E-07	mr1011_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0803457136	NA	3.28E-07	mr1013_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0803457136	NA	1.93E-14	mr1031_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0803457136	NA	3.15E-08	mr1031_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0803457136	NA	1.47E-06	mr1359_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0803457136	NA	9.31E-08	mr1449_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0803457136	NA	9.03E-08	mr1794_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251