Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0803452485:

Variant ID: vg0803452485 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 3452485
Reference Allele: G	Alternative Allele: A
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.83, A: 0.16, others allele: 0.00, population size: 103. )

Flanking Sequence (100 bp) in Reference Genome:

GTGCCACCAGTCGGAGGAGAGAGTAGTTGGCGGCACGTTGTTGAGTTGTGATCCAAATTCATTTGCACTTAATAAAGGCCAGCTTCTACCGTAGTGGAGC[G/A]
GAGGCCCGTCGCCGGTAGGCTTGGGCCGGAGCGTAGCGGATCATCATCCCTTTTAGGATTCCACCATATATATACCTCTTATAAGCCGCCGTGCGGCGAT

Reverse complement sequence

ATCGCCGCACGGCGGCTTATAAGAGGTATATATATGGTGGAATCCTAAAAGGGATGATGATCCGCTACGCTCCGGCCCAAGCCTACCGGCGACGGGCCTC[C/T]
GCTCCACTACGGTAGAAGCTGGCCTTTATTAAGTGCAAATGAATTTGGATCACAACTCAACAACGTGCCGCCAACTACTCTCTCCTCCGACTGGTGGCAC

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	52.20%	47.50%	0.21%	0.13%	NA
All Indica	2759	72.20%	27.30%	0.36%	0.14%	NA
All Japonica	1512	4.90%	95.10%	0.00%	0.00%	NA
Aus	269	98.90%	1.10%	0.00%	0.00%	NA
Indica I	595	88.90%	10.90%	0.17%	0.00%	NA
Indica II	465	34.80%	63.90%	0.65%	0.65%	NA
Indica III	913	78.40%	21.40%	0.22%	0.00%	NA
Indica Intermediate	786	74.40%	24.90%	0.51%	0.13%	NA
Temperate Japonica	767	0.30%	99.70%	0.00%	0.00%	NA
Tropical Japonica	504	12.90%	87.10%	0.00%	0.00%	NA
Japonica Intermediate	241	2.90%	97.10%	0.00%	0.00%	NA
VI/Aromatic	96	90.60%	9.40%	0.00%	0.00%	NA
Intermediate	90	53.30%	44.40%	0.00%	2.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0803452485	G -> A	LOC_Os08g06260.1	downstream_gene_variant ; 4466.0bp to feature; MODIFIER	silent_mutation	Average:54.441; most accessible tissue: Zhenshan97 panicle, score: 76.605	N	N	N	N
vg0803452485	G -> A	LOC_Os08g06270.1	downstream_gene_variant ; 1922.0bp to feature; MODIFIER	silent_mutation	Average:54.441; most accessible tissue: Zhenshan97 panicle, score: 76.605	N	N	N	N
vg0803452485	G -> A	LOC_Os08g06270-LOC_Os08g06280	intergenic_region ; MODIFIER	silent_mutation	Average:54.441; most accessible tissue: Zhenshan97 panicle, score: 76.605	N	N	N	N
vg0803452485	G -> DEL	N	N	silent_mutation	Average:54.441; most accessible tissue: Zhenshan97 panicle, score: 76.605	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0803452485	NA	5.67E-06	mr1114	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0803452485	NA	1.10E-12	mr1149	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0803452485	NA	1.26E-07	mr1162	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0803452485	NA	1.87E-06	mr1510	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0803452485	NA	1.98E-10	mr1565	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0803452485	NA	1.11E-07	mr1739	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251