\
| Variant ID: vg0803418306 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 3418306 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
GCAAAAGTTTTTTTTGGTTGAGGGCAATACAAACAAGGAGGATGCATGCGCGTGAGAGGAGTTTATAGCAATACAATTAATGGTGAATATCCGATTGGAT[G/A]
TAGAGACGGTAGAGGCCTGATTTATCTTTTTTTTTTAAAAAAAAAACTACTACCTCAACCCCTAAAAGAACGTTGTTTTAGTATAAAGTTTTTACGGATA
TATCCGTAAAAACTTTATACTAAAACAACGTTCTTTTAGGGGTTGAGGTAGTAGTTTTTTTTTTAAAAAAAAAAGATAAATCAGGCCTCTACCGTCTCTA[C/T]
ATCCAATCGGATATTCACCATTAATTGTATTGCTATAAACTCCTCTCACGCGCATGCATCCTCCTTGTTTGTATTGCCCTCAACCAAAAAAAACTTTTGC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 86.10% | 13.80% | 0.15% | 0.00% | NA |
| All Indica | 2759 | 88.20% | 11.50% | 0.25% | 0.00% | NA |
| All Japonica | 1512 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Aus | 269 | 7.10% | 92.90% | 0.00% | 0.00% | NA |
| Indica I | 595 | 88.10% | 11.40% | 0.50% | 0.00% | NA |
| Indica II | 465 | 94.00% | 6.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 87.00% | 12.80% | 0.22% | 0.00% | NA |
| Indica Intermediate | 786 | 86.40% | 13.40% | 0.25% | 0.00% | NA |
| Temperate Japonica | 767 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.20% | 0.80% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 45.80% | 54.20% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 71.10% | 28.90% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0803418306 | G -> A | LOC_Os08g06180.1 | upstream_gene_variant ; 4912.0bp to feature; MODIFIER | silent_mutation | Average:61.671; most accessible tissue: Callus, score: 85.82 | N | N | N | N |
| vg0803418306 | G -> A | LOC_Os08g06190.1 | upstream_gene_variant ; 1135.0bp to feature; MODIFIER | silent_mutation | Average:61.671; most accessible tissue: Callus, score: 85.82 | N | N | N | N |
| vg0803418306 | G -> A | LOC_Os08g06200.1 | upstream_gene_variant ; 2263.0bp to feature; MODIFIER | silent_mutation | Average:61.671; most accessible tissue: Callus, score: 85.82 | N | N | N | N |
| vg0803418306 | G -> A | LOC_Os08g06190-LOC_Os08g06200 | intergenic_region ; MODIFIER | silent_mutation | Average:61.671; most accessible tissue: Callus, score: 85.82 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0803418306 | 1.27E-06 | 4.85E-07 | mr1310 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0803418306 | 1.32E-06 | 1.32E-06 | mr1359 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0803418306 | NA | 4.28E-06 | mr1414 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0803418306 | NA | 7.60E-06 | mr1564 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0803418306 | NA | 4.04E-06 | mr1800 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0803418306 | NA | 1.11E-06 | mr1236_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0803418306 | NA | 9.77E-06 | mr1236_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0803418306 | NA | 3.33E-06 | mr1522_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0803418306 | NA | 1.17E-09 | mr1705_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0803418306 | NA | 7.96E-07 | mr1743_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |