\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0803418306:

Variant ID: vg0803418306 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 3418306
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GCAAAAGTTTTTTTTGGTTGAGGGCAATACAAACAAGGAGGATGCATGCGCGTGAGAGGAGTTTATAGCAATACAATTAATGGTGAATATCCGATTGGAT[G/A]
TAGAGACGGTAGAGGCCTGATTTATCTTTTTTTTTTAAAAAAAAAACTACTACCTCAACCCCTAAAAGAACGTTGTTTTAGTATAAAGTTTTTACGGATA

Reverse complement sequence

TATCCGTAAAAACTTTATACTAAAACAACGTTCTTTTAGGGGTTGAGGTAGTAGTTTTTTTTTTAAAAAAAAAAGATAAATCAGGCCTCTACCGTCTCTA[C/T]
ATCCAATCGGATATTCACCATTAATTGTATTGCTATAAACTCCTCTCACGCGCATGCATCCTCCTTGTTTGTATTGCCCTCAACCAAAAAAAACTTTTGC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 86.10% 13.80% 0.15% 0.00% NA
All Indica  2759 88.20% 11.50% 0.25% 0.00% NA
All Japonica  1512 99.70% 0.30% 0.00% 0.00% NA
Aus  269 7.10% 92.90% 0.00% 0.00% NA
Indica I  595 88.10% 11.40% 0.50% 0.00% NA
Indica II  465 94.00% 6.00% 0.00% 0.00% NA
Indica III  913 87.00% 12.80% 0.22% 0.00% NA
Indica Intermediate  786 86.40% 13.40% 0.25% 0.00% NA
Temperate Japonica  767 99.90% 0.10% 0.00% 0.00% NA
Tropical Japonica  504 99.60% 0.40% 0.00% 0.00% NA
Japonica Intermediate  241 99.20% 0.80% 0.00% 0.00% NA
VI/Aromatic  96 45.80% 54.20% 0.00% 0.00% NA
Intermediate  90 71.10% 28.90% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0803418306 G -> A LOC_Os08g06180.1 upstream_gene_variant ; 4912.0bp to feature; MODIFIER silent_mutation Average:61.671; most accessible tissue: Callus, score: 85.82 N N N N
vg0803418306 G -> A LOC_Os08g06190.1 upstream_gene_variant ; 1135.0bp to feature; MODIFIER silent_mutation Average:61.671; most accessible tissue: Callus, score: 85.82 N N N N
vg0803418306 G -> A LOC_Os08g06200.1 upstream_gene_variant ; 2263.0bp to feature; MODIFIER silent_mutation Average:61.671; most accessible tissue: Callus, score: 85.82 N N N N
vg0803418306 G -> A LOC_Os08g06190-LOC_Os08g06200 intergenic_region ; MODIFIER silent_mutation Average:61.671; most accessible tissue: Callus, score: 85.82 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0803418306 1.27E-06 4.85E-07 mr1310 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0803418306 1.32E-06 1.32E-06 mr1359 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0803418306 NA 4.28E-06 mr1414 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0803418306 NA 7.60E-06 mr1564 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0803418306 NA 4.04E-06 mr1800 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0803418306 NA 1.11E-06 mr1236_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0803418306 NA 9.77E-06 mr1236_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0803418306 NA 3.33E-06 mr1522_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0803418306 NA 1.17E-09 mr1705_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0803418306 NA 7.96E-07 mr1743_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251