\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0803345287:

Variant ID: vg0803345287 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 3345287
Reference Allele: AAlternative Allele: T
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.78, A: 0.22, others allele: 0.00, population size: 107. )

Flanking Sequence (100 bp) in Reference Genome:


CCTCAAATCAAACCCCAAATCCCAAATCAAACAAAGTAACATCCCAAATCATTCATATCACAAATCCTAAGTTACTTATATACACAAATCAAATACATCA[A/T]
AAATCCTAAAAAAATGCACACAATTAAATCAAATACATCTCAGATCCATGCAAGTTATACATCTAAGTACATGAATCACAAATTATCCAAAAAAAAAGAG

Reverse complement sequence

CTCTTTTTTTTTGGATAATTTGTGATTCATGTACTTAGATGTATAACTTGCATGGATCTGAGATGTATTTGATTTAATTGTGTGCATTTTTTTAGGATTT[T/A]
TGATGTATTTGATTTGTGTATATAAGTAACTTAGGATTTGTGATATGAATGATTTGGGATGTTACTTTGTTTGATTTGGGATTTGGGGTTTGATTTGAGG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 59.60% 40.30% 0.06% 0.00% NA
All Indica  2759 85.20% 14.80% 0.04% 0.00% NA
All Japonica  1512 4.20% 95.80% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 91.90% 8.10% 0.00% 0.00% NA
Indica II  465 46.90% 53.10% 0.00% 0.00% NA
Indica III  913 99.80% 0.20% 0.00% 0.00% NA
Indica Intermediate  786 85.80% 14.10% 0.13% 0.00% NA
Temperate Japonica  767 0.40% 99.60% 0.00% 0.00% NA
Tropical Japonica  504 10.10% 89.90% 0.00% 0.00% NA
Japonica Intermediate  241 4.10% 95.90% 0.00% 0.00% NA
VI/Aromatic  96 90.60% 9.40% 0.00% 0.00% NA
Intermediate  90 53.30% 44.40% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0803345287 A -> T LOC_Os08g06100.1 upstream_gene_variant ; 4328.0bp to feature; MODIFIER silent_mutation Average:54.501; most accessible tissue: Zhenshan97 panicle, score: 71.253 N N N N
vg0803345287 A -> T LOC_Os08g06100-LOC_Os08g06110 intergenic_region ; MODIFIER silent_mutation Average:54.501; most accessible tissue: Zhenshan97 panicle, score: 71.253 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0803345287 NA 2.15E-06 mr1219 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0803345287 NA 2.94E-08 mr1565 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0803345287 3.11E-06 3.25E-07 mr1201_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0803345287 5.55E-06 1.35E-07 mr1219_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0803345287 6.52E-06 6.31E-07 mr1274_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251