\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0803326358:

Variant ID: vg0803326358 (JBrowse)Variation Type: INDEL
Chromosome: chr08Position: 3326358
Reference Allele: TATCAlternative Allele: T,CATC
Primary Allele: TSecondary Allele: TATC

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TACAACATCACTCAAAGCACATAGATATATGTGAGGCACAAGCACACACACACATCTAGTGGTGATGTGAGAGGCAGGCAAACTACTAATAGTACTATAT[TATC/T,CATC]
ATCATCATCATCATCATTATAAATTATTATTCCAATATTTGTCAAAGTGGAGGCAGGTATGTACACATCTCTCTCTCTTAATCCCCCCTTACAAATTAAG

Reverse complement sequence

CTTAATTTGTAAGGGGGGATTAAGAGAGAGAGATGTGTACATACCTGCCTCCACTTTGACAAATATTGGAATAATAATTTATAATGATGATGATGATGAT[GATA/A,GATG]
ATATAGTACTATTAGTAGTTTGCCTGCCTCTCACATCACCACTAGATGTGTGTGTGTGCTTGTGCCTCACATATATCTATGTGCTTTGAGTGATGTTGTA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of TATC(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 57.60% 40.20% 0.11% 0.00% CATC: 2.12%
All Indica  2759 81.90% 18.10% 0.07% 0.00% NA
All Japonica  1512 4.50% 88.70% 0.20% 0.00% CATC: 6.61%
Aus  269 97.80% 2.20% 0.00% 0.00% NA
Indica I  595 85.90% 14.10% 0.00% 0.00% NA
Indica II  465 41.50% 58.30% 0.22% 0.00% NA
Indica III  913 98.80% 1.20% 0.00% 0.00% NA
Indica Intermediate  786 83.10% 16.80% 0.13% 0.00% NA
Temperate Japonica  767 0.40% 86.40% 0.39% 0.00% CATC: 12.78%
Tropical Japonica  504 10.90% 89.10% 0.00% 0.00% NA
Japonica Intermediate  241 4.10% 95.00% 0.00% 0.00% CATC: 0.83%
VI/Aromatic  96 88.50% 11.50% 0.00% 0.00% NA
Intermediate  90 51.10% 48.90% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0803326358 TATC -> CATC LOC_Os08g06090.1 3_prime_UTR_variant ; 607.0bp to feature; MODIFIER silent_mutation Average:90.95; most accessible tissue: Minghui63 root, score: 97.378 N N N N
vg0803326358 TATC -> T LOC_Os08g06090.1 3_prime_UTR_variant ; 604.0bp to feature; MODIFIER silent_mutation Average:90.95; most accessible tissue: Minghui63 root, score: 97.378 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0803326358 TATC CATC 0.0 0.02 0.03 0.01 0.03 0.04
vg0803326358 TATC T 0.01 -0.08 -0.03 -0.03 -0.04 -0.06

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0803326358 1.07E-09 3.00E-14 mr1062 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0803326358 3.14E-06 6.26E-09 mr1062_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251