Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0803291998:

Variant ID: vg0803291998 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 3291998
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, others allele: 0.00, population size: 122. )

Flanking Sequence (100 bp) in Reference Genome:

TCTCTTTTCTCATTAAGCCACATCACCCCAATTATTTTTAACCCTTGGGTGATAGATGTATGGTTCAAATTGTTGACTCAAAATTCATAAGTATAAATTT[G/A]
TTTTAGTTTTAATAATCATGTTGCATCTTATTTATACATATTATACAATTTAATTTCCGGTAGCAACGCCGACGGGGTATTCATTTAGTTGCTAAGATGA

Reverse complement sequence

TCATCTTAGCAACTAAATGAATACCCCGTCGGCGTTGCTACCGGAAATTAAATTGTATAATATGTATAAATAAGATGCAACATGATTATTAAAACTAAAA[C/T]
AAATTTATACTTATGAATTTTGAGTCAACAATTTGAACCATACATCTATCACCCAAGGGTTAAAAATAATTGGGGTGATGTGGCTTAATGAGAAAAGAGA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	94.80%	3.00%	2.20%	0.00%	NA
All Indica	2759	91.20%	5.10%	3.70%	0.00%	NA
All Japonica	1512	99.90%	0.10%	0.00%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	78.20%	9.70%	12.10%	0.00%	NA
Indica II	465	86.90%	11.20%	1.94%	0.00%	NA
Indica III	913	99.70%	0.10%	0.22%	0.00%	NA
Indica Intermediate	786	93.60%	3.90%	2.42%	0.00%	NA
Temperate Japonica	767	100.00%	0.00%	0.00%	0.00%	NA
Tropical Japonica	504	100.00%	0.00%	0.00%	0.00%	NA
Japonica Intermediate	241	99.60%	0.40%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	96.70%	1.10%	2.22%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0803291998	G -> A	LOC_Os08g06020.1	upstream_gene_variant ; 2124.0bp to feature; MODIFIER	silent_mutation	Average:44.187; most accessible tissue: Callus, score: 79.209	N	N	N	N
vg0803291998	G -> A	LOC_Os08g06040.1	upstream_gene_variant ; 1125.0bp to feature; MODIFIER	silent_mutation	Average:44.187; most accessible tissue: Callus, score: 79.209	N	N	N	N
vg0803291998	G -> A	LOC_Os08g06020-LOC_Os08g06040	intergenic_region ; MODIFIER	silent_mutation	Average:44.187; most accessible tissue: Callus, score: 79.209	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0803291998	NA	1.05E-11	mr1352	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0803291998	NA	2.12E-09	mr1352	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0803291998	NA	5.58E-10	mr1546	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0803291998	NA	3.41E-07	mr1743	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0803291998	NA	2.12E-07	mr1743	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0803291998	NA	4.88E-07	mr1830_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251