\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0803262517:

Variant ID: vg0803262517 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 3262517
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GCAGGTCAGAGAAGCTCGTCTTCTTCAGGCTGTGTTTAGATCCAAACTTCAGTCCTTTTCCATCACATCAACCTGTCATACACACACAACTTTTCAGTCA[C/T]
ATCATCTTTAATTTCAACCAAAATCCAAACTTTGGATCCAACTAAACACAGCCTCAGCCTCATGGCAGCGGTCATTGTAGTCTTTACGCTATCACACGCT

Reverse complement sequence

AGCGTGTGATAGCGTAAAGACTACAATGACCGCTGCCATGAGGCTGAGGCTGTGTTTAGTTGGATCCAAAGTTTGGATTTTGGTTGAAATTAAAGATGAT[G/A]
TGACTGAAAAGTTGTGTGTGTATGACAGGTTGATGTGATGGAAAAGGACTGAAGTTTGGATCTAAACACAGCCTGAAGAAGACGAGCTTCTCTGACCTGC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 69.00% 6.10% 3.03% 21.88% NA
All Indica  2759 67.50% 0.00% 3.81% 28.71% NA
All Japonica  1512 80.90% 18.90% 0.00% 0.20% NA
Aus  269 4.50% 0.00% 14.13% 81.41% NA
Indica I  595 63.00% 0.00% 1.34% 35.63% NA
Indica II  465 84.90% 0.00% 1.08% 13.98% NA
Indica III  913 60.60% 0.00% 6.57% 32.86% NA
Indica Intermediate  786 68.60% 0.00% 4.07% 27.35% NA
Temperate Japonica  767 71.10% 28.90% 0.00% 0.00% NA
Tropical Japonica  504 95.00% 4.60% 0.00% 0.40% NA
Japonica Intermediate  241 82.60% 17.00% 0.00% 0.41% NA
VI/Aromatic  96 90.60% 1.00% 0.00% 8.33% NA
Intermediate  90 86.70% 0.00% 0.00% 13.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0803262517 C -> T LOC_Os08g05990-LOC_Os08g06000 intergenic_region ; MODIFIER silent_mutation Average:60.351; most accessible tissue: Zhenshan97 flag leaf, score: 92.752 N N N N
vg0803262517 C -> DEL N N silent_mutation Average:60.351; most accessible tissue: Zhenshan97 flag leaf, score: 92.752 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0803262517 C T -0.01 0.0 0.0 -0.03 -0.01 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0803262517 NA 1.23E-07 Awn_length Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0803262517 5.95E-07 NA mr1062 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0803262517 NA 5.77E-08 mr1062 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0803262517 3.79E-07 NA mr1143 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0803262517 2.22E-06 NA mr1167 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0803262517 NA 6.32E-06 mr1456 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0803262517 8.25E-06 8.25E-06 mr1456 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0803262517 9.11E-06 3.46E-10 mr1471 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0803262517 3.20E-06 NA mr1535 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0803262517 5.51E-06 NA mr1675 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0803262517 NA 3.49E-07 mr1815 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0803262517 2.65E-08 NA mr1995 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0803262517 2.29E-06 NA mr1062_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0803262517 NA 3.09E-08 mr1062_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0803262517 NA 3.49E-06 mr1780_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251