\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0803251090:

Variant ID: vg0803251090 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 3251090
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.92, T: 0.07, others allele: 0.00, population size: 80. )

Flanking Sequence (100 bp) in Reference Genome:


TAGGGTGCGGGCTGAGAGGAAAGGGGGAGGAAAGCGGAAAATTTAGGACCAATAGAGAAGAAATGGTAAAATAAGGCCCAATATAAGCAGTATAAGGTTT[C/T]
TTTTTTAATTTTTTTTAATACATATACACACTGTAGGGTATATATACCTATTTTTTGTCCAAAAAACTTAGGTATACATCTGAATACCCTTGAATACATA

Reverse complement sequence

TATGTATTCAAGGGTATTCAGATGTATACCTAAGTTTTTTGGACAAAAAATAGGTATATATACCCTACAGTGTGTATATGTATTAAAAAAAATTAAAAAA[G/A]
AAACCTTATACTGCTTATATTGGGCCTTATTTTACCATTTCTTCTCTATTGGTCCTAAATTTTCCGCTTTCCTCCCCCTTTCCTCTCAGCCCGCACCCTA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 35.00% 33.50% 1.90% 29.58% NA
All Indica  2759 53.40% 4.30% 2.07% 40.27% NA
All Japonica  1512 5.30% 94.00% 0.33% 0.33% NA
Aus  269 0.70% 0.40% 9.29% 89.59% NA
Indica I  595 46.10% 3.90% 4.03% 46.05% NA
Indica II  465 69.50% 10.50% 1.72% 18.28% NA
Indica III  913 47.00% 2.50% 1.20% 49.29% NA
Indica Intermediate  786 56.90% 2.90% 1.78% 38.42% NA
Temperate Japonica  767 1.70% 97.90% 0.39% 0.00% NA
Tropical Japonica  504 9.70% 89.50% 0.20% 0.60% NA
Japonica Intermediate  241 7.50% 91.30% 0.41% 0.83% NA
VI/Aromatic  96 64.60% 9.40% 2.08% 23.96% NA
Intermediate  90 42.20% 36.70% 1.11% 20.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0803251090 C -> T LOC_Os08g05990.1 upstream_gene_variant ; 3087.0bp to feature; MODIFIER silent_mutation Average:91.729; most accessible tissue: Zhenshan97 flag leaf, score: 99.087 N N N N
vg0803251090 C -> T LOC_Os08g05980.1 downstream_gene_variant ; 2541.0bp to feature; MODIFIER silent_mutation Average:91.729; most accessible tissue: Zhenshan97 flag leaf, score: 99.087 N N N N
vg0803251090 C -> T LOC_Os08g05980-LOC_Os08g05990 intergenic_region ; MODIFIER silent_mutation Average:91.729; most accessible tissue: Zhenshan97 flag leaf, score: 99.087 N N N N
vg0803251090 C -> DEL N N silent_mutation Average:91.729; most accessible tissue: Zhenshan97 flag leaf, score: 99.087 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0803251090 C T -0.02 -0.01 -0.01 -0.01 -0.02 -0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0803251090 NA 7.24E-54 Grain_width All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0803251090 NA 6.35E-17 mr1116 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0803251090 NA 4.18E-49 mr1136 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0803251090 NA 2.39E-45 mr1194 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0803251090 NA 1.29E-31 mr1243 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0803251090 NA 1.65E-26 mr1423 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0803251090 NA 1.63E-14 mr1653 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0803251090 NA 8.74E-59 mr1695 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0803251090 NA 1.23E-09 mr1714 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0803251090 NA 4.62E-18 mr1715 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0803251090 NA 2.68E-59 mr1136_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0803251090 NA 1.83E-12 mr1258_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0803251090 NA 3.28E-35 mr1448_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0803251090 NA 4.16E-58 mr1599_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0803251090 NA 1.42E-24 mr1653_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0803251090 NA 5.27E-63 mr1695_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0803251090 NA 4.53E-32 mr1780_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0803251090 NA 7.84E-11 mr1986_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251