\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0803246961:

Variant ID: vg0803246961 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 3246961
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.69, T: 0.31, others allele: 0.00, population size: 245. )

Flanking Sequence (100 bp) in Reference Genome:


TGTTGTCTACGTAGCACGGTTGACTTAGTCTTCATCTGATGCGGCACTATAGCTAGCGGAAAAAAAGATAAAAGTGGGATCCACATGTAAATTCCCCATC[C/T]
TATCTTCTTCCTCACTTCTCCCCCTTCTCTCCCCTCCTCCCCCTCGCTTTCCAGCGCTAGTAGAGATGCGGGATGGCTGCAGTGGCAAGGTAAATACAAC

Reverse complement sequence

GTTGTATTTACCTTGCCACTGCAGCCATCCCGCATCTCTACTAGCGCTGGAAAGCGAGGGGGAGGAGGGGAGAGAAGGGGGAGAAGTGAGGAAGAAGATA[G/A]
GATGGGGAATTTACATGTGGATCCCACTTTTATCTTTTTTTCCGCTAGCTATAGTGCCGCATCAGATGAAGACTAAGTCAACCGTGCTACGTAGACAACA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 81.40% 17.60% 0.08% 0.87% NA
All Indica  2759 88.90% 11.00% 0.04% 0.00% NA
All Japonica  1512 81.80% 15.30% 0.20% 2.71% NA
Aus  269 3.30% 96.70% 0.00% 0.00% NA
Indica I  595 99.80% 0.20% 0.00% 0.00% NA
Indica II  465 93.50% 6.50% 0.00% 0.00% NA
Indica III  913 82.50% 17.40% 0.11% 0.00% NA
Indica Intermediate  786 85.50% 14.50% 0.00% 0.00% NA
Temperate Japonica  767 70.70% 24.60% 0.26% 4.43% NA
Tropical Japonica  504 98.60% 1.20% 0.00% 0.20% NA
Japonica Intermediate  241 82.20% 14.90% 0.41% 2.49% NA
VI/Aromatic  96 72.90% 27.10% 0.00% 0.00% NA
Intermediate  90 85.60% 14.40% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0803246961 C -> T LOC_Os08g05980.1 upstream_gene_variant ; 1355.0bp to feature; MODIFIER silent_mutation Average:81.457; most accessible tissue: Minghui63 root, score: 96.07 N N N N
vg0803246961 C -> T LOC_Os08g05960.1 downstream_gene_variant ; 3522.0bp to feature; MODIFIER silent_mutation Average:81.457; most accessible tissue: Minghui63 root, score: 96.07 N N N N
vg0803246961 C -> T LOC_Os08g05970.1 downstream_gene_variant ; 2110.0bp to feature; MODIFIER silent_mutation Average:81.457; most accessible tissue: Minghui63 root, score: 96.07 N N N N
vg0803246961 C -> T LOC_Os08g05970-LOC_Os08g05980 intergenic_region ; MODIFIER silent_mutation Average:81.457; most accessible tissue: Minghui63 root, score: 96.07 N N N N
vg0803246961 C -> DEL N N silent_mutation Average:81.457; most accessible tissue: Minghui63 root, score: 96.07 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0803246961 C T 0.03 -0.01 -0.02 -0.02 -0.01 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0803246961 NA 1.14E-07 Awn_length Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0803246961 NA 1.84E-07 mr1062 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0803246961 NA 6.95E-07 mr1126 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0803246961 NA 1.27E-06 mr1280 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0803246961 NA 2.78E-06 mr1531 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0803246961 3.64E-06 NA mr1942 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0803246961 NA 1.66E-07 mr1062_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0803246961 NA 8.30E-07 mr1780_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251