\
| Variant ID: vg0803181124 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 3181124 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
CACATATTATATAAGAAGGTGCCCGCGCATGTGCGCGGGCTATCTTTCTAGTTGAAACAAAAGTTGTTCAACCTGGCTAGGGTCAGGGATCACCGGTGTC[G/A]
TCGTATTCGTCTTCGATCGGGGGGCTGTATTCCGTACGCTTCACCTTGCAAACCACGTCGCCACTATTACTGTCCTTGTCGACGCCGGCGCCTTGGATTG
CAATCCAAGGCGCCGGCGTCGACAAGGACAGTAATAGTGGCGACGTGGTTTGCAAGGTGAAGCGTACGGAATACAGCCCCCCGATCGAAGACGAATACGA[C/T]
GACACCGGTGATCCCTGACCCTAGCCAGGTTGAACAACTTTTGTTTCAACTAGAAAGATAGCCCGCGCACATGCGCGGGCACCTTCTTATATAATATGTG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 93.80% | 6.20% | 0.00% | 0.00% | NA |
| All Indica | 2759 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 80.90% | 19.10% | 0.00% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 68.30% | 31.70% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.20% | 0.80% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 82.60% | 17.40% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0803181124 | G -> A | LOC_Os08g05910.1 | downstream_gene_variant ; 1185.0bp to feature; MODIFIER | silent_mutation | Average:56.569; most accessible tissue: Zhenshan97 panicle, score: 79.799 | N | N | N | N |
| vg0803181124 | G -> A | LOC_Os08g05910.2 | downstream_gene_variant ; 1210.0bp to feature; MODIFIER | silent_mutation | Average:56.569; most accessible tissue: Zhenshan97 panicle, score: 79.799 | N | N | N | N |
| vg0803181124 | G -> A | LOC_Os08g05900-LOC_Os08g05910 | intergenic_region ; MODIFIER | silent_mutation | Average:56.569; most accessible tissue: Zhenshan97 panicle, score: 79.799 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0803181124 | NA | 6.35E-08 | Awn_length | Jap_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0803181124 | 2.33E-07 | NA | mr1062 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0803181124 | NA | 3.13E-07 | mr1062 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0803181124 | 7.62E-06 | 2.48E-07 | mr1343 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0803181124 | 7.62E-07 | 9.66E-08 | mr1456 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0803181124 | NA | 4.26E-06 | mr1531 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0803181124 | NA | 5.87E-09 | mr1624 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0803181124 | NA | 2.60E-06 | mr1815 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0803181124 | 8.17E-06 | NA | mr1995 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0803181124 | NA | 5.01E-07 | mr1062_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0803181124 | NA | 5.85E-06 | mr1577_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0803181124 | NA | 2.28E-07 | mr1780_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |