\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0803095828:

Variant ID: vg0803095828 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 3095828
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.96, C: 0.04, others allele: 0.00, population size: 209. )

Flanking Sequence (100 bp) in Reference Genome:


TCGAAAGTCAACAGCGTCATACATTAAAATACGGAGGGAGTACTATGTAGATAGCCACAACAATGAACTATAGTAGTGCCTCTCTGCATTCGCGCATGCA[C/T]
GCAACATTGCAAGTCTTCATCATCCATGATTTTCTTTTCCCCTTTGAAAAAACAGAGAAAATATGCGTTTTCTGCGTCCATGTCGTCGTCATTGCACACG

Reverse complement sequence

CGTGTGCAATGACGACGACATGGACGCAGAAAACGCATATTTTCTCTGTTTTTTCAAAGGGGAAAAGAAAATCATGGATGATGAAGACTTGCAATGTTGC[G/A]
TGCATGCGCGAATGCAGAGAGGCACTACTATAGTTCATTGTTGTGGCTATCTACATAGTACTCCCTCCGTATTTTAATGTATGACGCTGTTGACTTTCGA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 64.10% 35.40% 0.49% 0.02% NA
All Indica  2759 55.70% 43.90% 0.40% 0.00% NA
All Japonica  1512 89.10% 10.30% 0.60% 0.00% NA
Aus  269 0.40% 99.60% 0.00% 0.00% NA
Indica I  595 51.30% 48.40% 0.34% 0.00% NA
Indica II  465 79.80% 19.80% 0.43% 0.00% NA
Indica III  913 42.80% 56.80% 0.33% 0.00% NA
Indica Intermediate  786 59.80% 39.70% 0.51% 0.00% NA
Temperate Japonica  767 86.30% 12.80% 0.91% 0.00% NA
Tropical Japonica  504 96.60% 3.40% 0.00% 0.00% NA
Japonica Intermediate  241 82.20% 17.00% 0.83% 0.00% NA
VI/Aromatic  96 77.10% 20.80% 2.08% 0.00% NA
Intermediate  90 77.80% 20.00% 1.11% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0803095828 C -> T LOC_Os08g05780.1 upstream_gene_variant ; 949.0bp to feature; MODIFIER silent_mutation Average:62.237; most accessible tissue: Zhenshan97 root, score: 89.27 N N N N
vg0803095828 C -> T LOC_Os08g05780-LOC_Os08g05790 intergenic_region ; MODIFIER silent_mutation Average:62.237; most accessible tissue: Zhenshan97 root, score: 89.27 N N N N
vg0803095828 C -> DEL N N silent_mutation Average:62.237; most accessible tissue: Zhenshan97 root, score: 89.27 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0803095828 C T -0.05 -0.13 -0.1 -0.05 -0.12 -0.1

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0803095828 NA 8.72E-07 mr1167_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0803095828 NA 3.33E-06 mr1377_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0803095828 NA 1.66E-08 mr1707_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0803095828 NA 8.80E-06 mr1726_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0803095828 NA 7.52E-07 mr1781_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0803095828 5.50E-06 5.50E-06 mr1950_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251