Variant ID: vg0802960649 (JBrowse) | Variation Type: SNP |
Chromosome: chr08 | Position: 2960649 |
Reference Allele: A | Alternative Allele: G |
Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 263. )
ACCACTTAGTCCCGCTTAGATGTAAACTCGTCTATCACCACTATAGATTATCATTGTCTTGAAAGGAATTGTATTTGTACCATCAAAATAAGCCTAACAT[A/G]
TCATTAATACAATAAAAAAATCATGCACACTTCACACATAAGTGTTCATGTCTTACTTATGTTTAAATTTATGTATAAATACACTAAAAATACCGTTTCT
AGAAACGGTATTTTTAGTGTATTTATACATAAATTTAAACATAAGTAAGACATGAACACTTATGTGTGAAGTGTGCATGATTTTTTTATTGTATTAATGA[T/C]
ATGTTAGGCTTATTTTGATGGTACAAATACAATTCCTTTCAAGACAATGATAATCTATAGTGGTGATAGACGAGTTTACATCTAAGCGGGACTAAGTGGT
Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 98.70% | 1.20% | 0.08% | 0.00% | NA |
All Indica | 2759 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
All Japonica | 1512 | 96.00% | 3.70% | 0.26% | 0.00% | NA |
Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Indica Intermediate | 786 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Tropical Japonica | 504 | 89.50% | 9.70% | 0.79% | 0.00% | NA |
Japonica Intermediate | 241 | 97.10% | 2.90% | 0.00% | 0.00% | NA |
VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Intermediate | 90 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg0802960649 | A -> G | LOC_Os08g05530.1 | upstream_gene_variant ; 4709.0bp to feature; MODIFIER | silent_mutation | Average:32.844; most accessible tissue: Minghui63 flag leaf, score: 41.254 | N | N | N | N |
vg0802960649 | A -> G | LOC_Os08g05520-LOC_Os08g05530 | intergenic_region ; MODIFIER | silent_mutation | Average:32.844; most accessible tissue: Minghui63 flag leaf, score: 41.254 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg0802960649 | NA | 1.13E-07 | mr1136 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0802960649 | NA | 1.33E-07 | mr1188 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0802960649 | NA | 5.53E-08 | mr1136_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0802960649 | NA | 1.10E-08 | mr1188_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0802960649 | 8.00E-07 | 7.99E-07 | mr1448_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |