\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0802944461:

Variant ID: vg0802944461 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 2944461
Reference Allele: TAlternative Allele: G
Primary Allele: TSecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.63, T: 0.36, others allele: 0.00, population size: 103. )

Flanking Sequence (100 bp) in Reference Genome:


TTTGAAACCCTTTTTACTTTTATGAATTATGATCCAAGAAACCTTCCCATACTGTCCTAGAACCTAAAACAAAGCAATTCCAATTTTATTAGAATTAATT[T/G]
TTAACCCATCTTTTGATCTTAAACCTATTATTTGATTCTTGATCCAAATTCTTCCTTTTGATCTAGCCACTGATTTAATTCATGTGGCTTGATTTCCTCT

Reverse complement sequence

AGAGGAAATCAAGCCACATGAATTAAATCAGTGGCTAGATCAAAAGGAAGAATTTGGATCAAGAATCAAATAATAGGTTTAAGATCAAAAGATGGGTTAA[A/C]
AATTAATTCTAATAAAATTGGAATTGCTTTGTTTTAGGTTCTAGGACAGTATGGGAAGGTTTCTTGGATCATAATTCATAAAAGTAAAAAGGGTTTCAAA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 96.70% 3.30% 0.00% 0.00% NA
All Indica  2759 94.50% 5.50% 0.00% 0.00% NA
All Japonica  1512 99.90% 0.10% 0.00% 0.00% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 98.30% 1.70% 0.00% 0.00% NA
Indica III  913 87.30% 12.70% 0.00% 0.00% NA
Indica Intermediate  786 96.60% 3.40% 0.00% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 99.60% 0.40% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 96.70% 3.30% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0802944461 T -> G LOC_Os08g05510.1 downstream_gene_variant ; 4264.0bp to feature; MODIFIER silent_mutation Average:17.568; most accessible tissue: Callus, score: 31.285 N N N N
vg0802944461 T -> G LOC_Os08g05520.1 downstream_gene_variant ; 4061.0bp to feature; MODIFIER silent_mutation Average:17.568; most accessible tissue: Callus, score: 31.285 N N N N
vg0802944461 T -> G LOC_Os08g05510.2 downstream_gene_variant ; 4353.0bp to feature; MODIFIER silent_mutation Average:17.568; most accessible tissue: Callus, score: 31.285 N N N N
vg0802944461 T -> G LOC_Os08g05510-LOC_Os08g05520 intergenic_region ; MODIFIER silent_mutation Average:17.568; most accessible tissue: Callus, score: 31.285 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0802944461 6.70E-06 6.70E-06 mr1367_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0802944461 9.07E-07 1.08E-07 mr1425_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0802944461 2.49E-06 5.36E-07 mr1447_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0802944461 5.98E-09 1.55E-08 mr1748_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251