Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0802917283:

Variant ID: vg0802917283 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 2917283
Reference Allele: T	Alternative Allele: G
Primary Allele: G	Secondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.58, T: 0.45, others allele: 0.00, population size: 36. )

Flanking Sequence (100 bp) in Reference Genome:

TAGCTCGTTAGTCCGTGTGTTTAAGTTTTGCGTTTTCGTGGTGAGATTAGTGTTTTTTTTTTGGAGGATTTTATGAAATAGGGTCATAGTTTGTAAGTGA[T/G]
GTCAAATGAATCGTAGCATATATCGATCTGTCCTTAGACTTGTTCAACAATATCCCTTCACATTTTAATGGAAGGAGTATGCATTTTAGCAATTATACCG

Reverse complement sequence

CGGTATAATTGCTAAAATGCATACTCCTTCCATTAAAATGTGAAGGGATATTGTTGAACAAGTCTAAGGACAGATCGATATATGCTACGATTCATTTGAC[A/C]
TCACTTACAAACTATGACCCTATTTCATAAAATCCTCCAAAAAAAAAACACTAATCTCACCACGAAAACGCAAAACTTAAACACACGGACTAACGAGCTA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	75.10%	23.70%	1.04%	0.23%	NA
All Indica	2759	97.40%	1.20%	1.16%	0.18%	NA
All Japonica	1512	28.70%	70.30%	0.99%	0.00%	NA
Aus	269	97.80%	0.00%	0.37%	1.86%	NA
Indica I	595	97.10%	2.20%	0.67%	0.00%	NA
Indica II	465	98.70%	1.10%	0.22%	0.00%	NA
Indica III	913	97.00%	0.10%	2.52%	0.33%	NA
Indica Intermediate	786	97.30%	1.90%	0.51%	0.25%	NA
Temperate Japonica	767	15.60%	82.80%	1.56%	0.00%	NA
Tropical Japonica	504	35.10%	64.70%	0.20%	0.00%	NA
Japonica Intermediate	241	56.80%	42.30%	0.83%	0.00%	NA
VI/Aromatic	96	99.00%	0.00%	0.00%	1.04%	NA
Intermediate	90	74.40%	24.40%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0802917283	T -> G	LOC_Os08g05470.1	upstream_gene_variant ; 4745.0bp to feature; MODIFIER	silent_mutation	Average:75.219; most accessible tissue: Zhenshan97 flag leaf, score: 92.686	N	N	N	N
vg0802917283	T -> G	LOC_Os08g05480.1	upstream_gene_variant ; 1353.0bp to feature; MODIFIER	silent_mutation	Average:75.219; most accessible tissue: Zhenshan97 flag leaf, score: 92.686	N	N	N	N
vg0802917283	T -> G	LOC_Os08g05470-LOC_Os08g05480	intergenic_region ; MODIFIER	silent_mutation	Average:75.219; most accessible tissue: Zhenshan97 flag leaf, score: 92.686	N	N	N	N
vg0802917283	T -> DEL	N	N	silent_mutation	Average:75.219; most accessible tissue: Zhenshan97 flag leaf, score: 92.686	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg0802917283	T	G	0.0	-0.01	-0.01	0.01	0.01	0.0

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0802917283	NA	4.49E-06	mr1066_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0802917283	NA	6.71E-10	mr1232_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0802917283	NA	5.90E-07	mr1275_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0802917283	NA	4.35E-21	mr1298_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0802917283	NA	1.74E-14	mr1575_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0802917283	NA	1.02E-06	mr1662_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0802917283	4.08E-06	NA	mr1670_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0802917283	NA	1.94E-08	mr1681_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0802917283	NA	3.20E-11	mr1714_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0802917283	NA	1.67E-20	mr1731_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0802917283	NA	1.51E-07	mr1765_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0802917283	NA	2.85E-08	mr1909_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0802917283	NA	3.25E-08	mr1921_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0802917283	NA	9.92E-10	mr1940_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251