| Variant ID: vg0802877898 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 2877898 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
CTCCGATAAGAGTAGCTATAAGATTATAAACCAGCTATAAACATATTTTAAGAAGATAAAAGAGGAGAGATAAGAGCAACGGATTATAAATTTATAGCCA[G/A]
CTGCAGCACAGACTCCAAAATACATGTGTGTATGACAGGTGAGATCAGACATTAATTATATAGTACATTTTTATAGATAACTATTGTATGAATTGACTTT
AAAGTCAATTCATACAATAGTTATCTATAAAAATGTACTATATAATTAATGTCTGATCTCACCTGTCATACACACATGTATTTTGGAGTCTGTGCTGCAG[C/T]
TGGCTATAAATTTATAATCCGTTGCTCTTATCTCTCCTCTTTTATCTTCTTAAAATATGTTTATAGCTGGTTTATAATCTTATAGCTACTCTTATCGGAG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 36.60% | 1.80% | 2.60% | 59.01% | NA |
| All Indica | 2759 | 12.10% | 0.00% | 2.75% | 85.10% | NA |
| All Japonica | 1512 | 71.40% | 5.20% | 2.38% | 21.03% | NA |
| Aus | 269 | 98.10% | 0.70% | 1.12% | 0.00% | NA |
| Indica I | 595 | 4.40% | 0.00% | 4.87% | 90.76% | NA |
| Indica II | 465 | 11.40% | 0.00% | 3.66% | 84.95% | NA |
| Indica III | 913 | 13.60% | 0.00% | 0.77% | 85.65% | NA |
| Indica Intermediate | 786 | 16.80% | 0.00% | 2.93% | 80.28% | NA |
| Temperate Japonica | 767 | 85.30% | 0.00% | 3.13% | 11.60% | NA |
| Tropical Japonica | 504 | 64.50% | 13.70% | 1.98% | 19.84% | NA |
| Japonica Intermediate | 241 | 41.90% | 3.70% | 0.83% | 53.53% | NA |
| VI/Aromatic | 96 | 14.60% | 0.00% | 1.04% | 84.38% | NA |
| Intermediate | 90 | 38.90% | 6.70% | 7.78% | 46.67% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0802877898 | G -> A | LOC_Os08g05440.1 | upstream_gene_variant ; 1055.0bp to feature; MODIFIER | silent_mutation | Average:16.313; most accessible tissue: Callus, score: 48.565 | N | N | N | N |
| vg0802877898 | G -> A | LOC_Os08g05430-LOC_Os08g05440 | intergenic_region ; MODIFIER | silent_mutation | Average:16.313; most accessible tissue: Callus, score: 48.565 | N | N | N | N |
| vg0802877898 | G -> DEL | N | N | silent_mutation | Average:16.313; most accessible tissue: Callus, score: 48.565 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0802877898 | NA | 6.67E-06 | mr1125 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0802877898 | NA | 3.20E-07 | mr1136 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0802877898 | NA | 6.12E-08 | mr1188 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0802877898 | 4.91E-06 | 4.80E-08 | mr1448 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0802877898 | NA | 2.53E-10 | mr1188_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0802877898 | 3.37E-06 | 3.37E-06 | mr1448_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |