\
| Variant ID: vg0802472843 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 2472843 |
| Reference Allele: C | Alternative Allele: A,T |
| Primary Allele: C | Secondary Allele: A |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 218. )
ATTTCCTCCAAAATCCACATGCAATGTGCCATTCCATAGGAATTTCATAGGATTTGGAAAGCTTCAATCCTTTGAATCAAAGGGCCAAATAGGAAAATTT[C/A,T]
CTATAGGATTTGAATCCTATAAAATTCCTATATAAATCCATCCTTTGATTCAAATGGGCCCTAAATGTCCGGTTTTGACCATTGGCAAAAATATGTAGCA
TGCTACATATTTTTGCCAATGGTCAAAACCGGACATTTAGGGCCCATTTGAATCAAAGGATGGATTTATATAGGAATTTTATAGGATTCAAATCCTATAG[G/T,A]
AAATTTTCCTATTTGGCCCTTTGATTCAAAGGATTGAAGCTTTCCAAATCCTATGAAATTCCTATGGAATGGCACATTGCATGTGGATTTTGGAGGAAAT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 88.70% | 10.70% | 0.15% | 0.49% | T: 0.02% |
| All Indica | 2759 | 82.20% | 17.60% | 0.00% | 0.22% | NA |
| All Japonica | 1512 | 99.60% | 0.00% | 0.26% | 0.07% | T: 0.07% |
| Aus | 269 | 90.70% | 2.20% | 1.12% | 5.95% | NA |
| Indica I | 595 | 98.80% | 1.20% | 0.00% | 0.00% | NA |
| Indica II | 465 | 84.90% | 14.00% | 0.00% | 1.08% | NA |
| Indica III | 913 | 68.00% | 32.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 84.40% | 15.50% | 0.00% | 0.13% | NA |
| Temperate Japonica | 767 | 99.60% | 0.00% | 0.26% | 0.00% | T: 0.13% |
| Tropical Japonica | 504 | 99.60% | 0.00% | 0.20% | 0.20% | NA |
| Japonica Intermediate | 241 | 99.60% | 0.00% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 97.90% | 2.10% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 88.90% | 11.10% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0802472843 | C -> T | LOC_Os08g04860-LOC_Os08g04870 | intergenic_region ; MODIFIER | silent_mutation | Average:19.173; most accessible tissue: Zhenshan97 flower, score: 27.882 | N | N | N | N |
| vg0802472843 | C -> A | LOC_Os08g04860-LOC_Os08g04870 | intergenic_region ; MODIFIER | silent_mutation | Average:19.173; most accessible tissue: Zhenshan97 flower, score: 27.882 | N | N | N | N |
| vg0802472843 | C -> DEL | N | N | silent_mutation | Average:19.173; most accessible tissue: Zhenshan97 flower, score: 27.882 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0802472843 | NA | 6.07E-07 | mr1593 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0802472843 | NA | 1.29E-08 | mr1036_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0802472843 | NA | 4.89E-09 | mr1036_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0802472843 | NA | 2.61E-06 | mr1169_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0802472843 | NA | 2.64E-07 | mr1593_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0802472843 | NA | 2.75E-07 | mr1923_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |