\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0802472843:

Variant ID: vg0802472843 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 2472843
Reference Allele: CAlternative Allele: A,T
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 218. )

Flanking Sequence (100 bp) in Reference Genome:


ATTTCCTCCAAAATCCACATGCAATGTGCCATTCCATAGGAATTTCATAGGATTTGGAAAGCTTCAATCCTTTGAATCAAAGGGCCAAATAGGAAAATTT[C/A,T]
CTATAGGATTTGAATCCTATAAAATTCCTATATAAATCCATCCTTTGATTCAAATGGGCCCTAAATGTCCGGTTTTGACCATTGGCAAAAATATGTAGCA

Reverse complement sequence

TGCTACATATTTTTGCCAATGGTCAAAACCGGACATTTAGGGCCCATTTGAATCAAAGGATGGATTTATATAGGAATTTTATAGGATTCAAATCCTATAG[G/T,A]
AAATTTTCCTATTTGGCCCTTTGATTCAAAGGATTGAAGCTTTCCAAATCCTATGAAATTCCTATGGAATGGCACATTGCATGTGGATTTTGGAGGAAAT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 88.70% 10.70% 0.15% 0.49% T: 0.02%
All Indica  2759 82.20% 17.60% 0.00% 0.22% NA
All Japonica  1512 99.60% 0.00% 0.26% 0.07% T: 0.07%
Aus  269 90.70% 2.20% 1.12% 5.95% NA
Indica I  595 98.80% 1.20% 0.00% 0.00% NA
Indica II  465 84.90% 14.00% 0.00% 1.08% NA
Indica III  913 68.00% 32.00% 0.00% 0.00% NA
Indica Intermediate  786 84.40% 15.50% 0.00% 0.13% NA
Temperate Japonica  767 99.60% 0.00% 0.26% 0.00% T: 0.13%
Tropical Japonica  504 99.60% 0.00% 0.20% 0.20% NA
Japonica Intermediate  241 99.60% 0.00% 0.41% 0.00% NA
VI/Aromatic  96 97.90% 2.10% 0.00% 0.00% NA
Intermediate  90 88.90% 11.10% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0802472843 C -> T LOC_Os08g04860-LOC_Os08g04870 intergenic_region ; MODIFIER silent_mutation Average:19.173; most accessible tissue: Zhenshan97 flower, score: 27.882 N N N N
vg0802472843 C -> A LOC_Os08g04860-LOC_Os08g04870 intergenic_region ; MODIFIER silent_mutation Average:19.173; most accessible tissue: Zhenshan97 flower, score: 27.882 N N N N
vg0802472843 C -> DEL N N silent_mutation Average:19.173; most accessible tissue: Zhenshan97 flower, score: 27.882 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0802472843 NA 6.07E-07 mr1593 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0802472843 NA 1.29E-08 mr1036_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0802472843 NA 4.89E-09 mr1036_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0802472843 NA 2.61E-06 mr1169_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0802472843 NA 2.64E-07 mr1593_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0802472843 NA 2.75E-07 mr1923_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251