\
| Variant ID: vg0802232200 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 2232200 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, A: 0.01, others allele: 0.00, population size: 107. )
TAAAAGAATTGCACGTCAATATATTAGCAGGAAAAGAGTTTTTGTTACACAAAGTAATCAGCTAGACTGGCTTATGCCTAAAGGGGGGACTTGAAGCTAG[G/A]
AACTACTACGACGGTTAAAAACGCAACTCCAAACAGCGGGAGGGGGGCAGAGCCACGCTACACTCCCAAGAAATCCCCAAAACAAGTAACACTAGCTAAA
TTTAGCTAGTGTTACTTGTTTTGGGGATTTCTTGGGAGTGTAGCGTGGCTCTGCCCCCCTCCCGCTGTTTGGAGTTGCGTTTTTAACCGTCGTAGTAGTT[C/T]
CTAGCTTCAAGTCCCCCCTTTAGGCATAAGCCAGTCTAGCTGATTACTTTGTGTAACAAAAACTCTTTTCCTGCTAATATATTGACGTGCAATTCTTTTA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 70.70% | 19.70% | 2.14% | 7.49% | NA |
| All Indica | 2759 | 53.30% | 33.10% | 1.12% | 12.43% | NA |
| All Japonica | 1512 | 99.50% | 0.20% | 0.07% | 0.20% | NA |
| Aus | 269 | 74.00% | 0.00% | 24.91% | 1.12% | NA |
| Indica I | 595 | 60.70% | 38.00% | 0.34% | 1.01% | NA |
| Indica II | 465 | 80.00% | 14.40% | 0.86% | 4.73% | NA |
| Indica III | 913 | 36.70% | 32.20% | 1.42% | 29.68% | NA |
| Indica Intermediate | 786 | 51.30% | 41.60% | 1.53% | 5.60% | NA |
| Temperate Japonica | 767 | 99.60% | 0.10% | 0.13% | 0.13% | NA |
| Tropical Japonica | 504 | 99.40% | 0.20% | 0.00% | 0.40% | NA |
| Japonica Intermediate | 241 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 96.90% | 3.10% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 78.90% | 13.30% | 2.22% | 5.56% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0802232200 | G -> A | LOC_Os08g04520.1 | downstream_gene_variant ; 477.0bp to feature; MODIFIER | silent_mutation | Average:42.388; most accessible tissue: Minghui63 flag leaf, score: 61.847 | N | N | N | N |
| vg0802232200 | G -> A | LOC_Os08g04510-LOC_Os08g04520 | intergenic_region ; MODIFIER | silent_mutation | Average:42.388; most accessible tissue: Minghui63 flag leaf, score: 61.847 | N | N | N | N |
| vg0802232200 | G -> DEL | N | N | silent_mutation | Average:42.388; most accessible tissue: Minghui63 flag leaf, score: 61.847 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0802232200 | NA | 1.39E-08 | mr1593 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0802232200 | NA | 6.17E-09 | mr1593 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0802232200 | NA | 7.56E-06 | mr1627 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0802232200 | 2.81E-40 | 1.23E-62 | mr1739 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0802232200 | 5.79E-37 | 1.43E-63 | mr1739 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0802232200 | NA | 1.09E-06 | mr1268_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0802232200 | NA | 2.54E-08 | mr1327_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0802232200 | NA | 1.23E-06 | mr1378_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0802232200 | NA | 1.99E-08 | mr1593_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0802232200 | 9.31E-45 | 9.66E-64 | mr1739_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0802232200 | 1.90E-43 | 7.35E-72 | mr1739_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |