\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0802224907:

Variant ID: vg0802224907 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 2224907
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 100. )

Flanking Sequence (100 bp) in Reference Genome:


GGAAACGGGCGAGGTCACGAAGCTGAGCGACGTGGTGACCCTCACCAAAACCGTGGGAACTGAAGCTGGAGTTCACTGCCATCTACAATTTTGAAAGAGG[G/A]
AGAAGGATCAGTAACCATTTTAGAAACAAACTATTGAAAATAAGGAAACCAAAAGAAGCCTTAGCTTTTCGCAAGCAGTTTTGAACTTAGTATCCTTAGG

Reverse complement sequence

CCTAAGGATACTAAGTTCAAAACTGCTTGCGAAAAGCTAAGGCTTCTTTTGGTTTCCTTATTTTCAATAGTTTGTTTCTAAAATGGTTACTGATCCTTCT[C/T]
CCTCTTTCAAAATTGTAGATGGCAGTGAACTCCAGCTTCAGTTCCCACGGTTTTGGTGAGGGTCACCACGTCGCTCAGCTTCGTGACCTCGCCCGTTTCC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 37.10% 18.00% 36.01% 8.89% NA
All Indica  2759 5.00% 30.20% 52.01% 12.76% NA
All Japonica  1512 97.10% 0.20% 1.26% 1.46% NA
Aus  269 7.40% 1.50% 76.95% 14.13% NA
Indica I  595 1.80% 37.50% 38.82% 21.85% NA
Indica II  465 10.50% 14.80% 60.65% 13.98% NA
Indica III  913 3.60% 28.50% 61.77% 6.13% NA
Indica Intermediate  786 5.90% 35.80% 45.55% 12.85% NA
Temperate Japonica  767 98.20% 0.00% 1.30% 0.52% NA
Tropical Japonica  504 97.00% 0.20% 0.79% 1.98% NA
Japonica Intermediate  241 93.80% 0.80% 2.07% 3.32% NA
VI/Aromatic  96 89.60% 2.10% 7.29% 1.04% NA
Intermediate  90 46.70% 7.80% 37.78% 7.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0802224907 G -> A LOC_Os08g04510.1 upstream_gene_variant ; 19.0bp to feature; MODIFIER silent_mutation Average:16.355; most accessible tissue: Minghui63 young leaf, score: 24.836 N N N N
vg0802224907 G -> A LOC_Os08g04510-LOC_Os08g04520 intergenic_region ; MODIFIER silent_mutation Average:16.355; most accessible tissue: Minghui63 young leaf, score: 24.836 N N N N
vg0802224907 G -> DEL N N silent_mutation Average:16.355; most accessible tissue: Minghui63 young leaf, score: 24.836 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0802224907 NA 2.10E-12 mr1281 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0802224907 NA 1.29E-27 mr1309 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0802224907 NA 7.41E-19 mr1484 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0802224907 NA 1.12E-19 mr1541 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0802224907 NA 2.25E-20 mr1566 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0802224907 NA 9.34E-23 mr1841 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0802224907 NA 3.83E-14 mr1333_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0802224907 NA 1.90E-19 mr1900_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251