| Variant ID: vg0802219193 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 2219193 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
TCAGATTCTTTTCCAGTTCGATATTACCCAGGGGGACTTGCTCTTCTGGAACTCGAAGACATTTCTTTAGCTGGGATACGTGGAACACGTTATGCACATC[T/C]
GCGAGACCTTCAGGTAACTCAAGCTGATAAGCCACTTCGCCACGTCTGGCGGTTATGAGGTAGGGGCCGATGTAGCGGGGTGCTAACTAGCCGGACATCC
GGATGTCCGGCTAGTTAGCACCCCGCTACATCGGCCCCTACCTCATAACCGCCAGACGTGGCGAAGTGGCTTATCAGCTTGAGTTACCTGAAGGTCTCGC[A/G]
GATGTGCATAACGTGTTCCACGTATCCCAGCTAAAGAAATGTCTTCGAGTTCCAGAAGAGCAAGTCCCCCTGGGTAATATCGAACTGGAAAAGAATCTGA
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 50.10% | 4.30% | 30.70% | 14.83% | NA |
| All Indica | 2759 | 27.50% | 7.20% | 46.54% | 18.74% | NA |
| All Japonica | 1512 | 97.20% | 0.00% | 1.19% | 1.65% | NA |
| Aus | 269 | 3.70% | 1.10% | 43.12% | 52.04% | NA |
| Indica I | 595 | 20.30% | 5.90% | 46.55% | 27.23% | NA |
| Indica II | 465 | 18.70% | 6.70% | 38.06% | 36.56% | NA |
| Indica III | 913 | 37.50% | 8.80% | 49.84% | 3.94% | NA |
| Indica Intermediate | 786 | 26.50% | 6.90% | 47.71% | 18.96% | NA |
| Temperate Japonica | 767 | 98.30% | 0.00% | 1.04% | 0.65% | NA |
| Tropical Japonica | 504 | 97.00% | 0.00% | 0.99% | 1.98% | NA |
| Japonica Intermediate | 241 | 93.80% | 0.00% | 2.07% | 4.15% | NA |
| VI/Aromatic | 96 | 88.50% | 0.00% | 8.33% | 3.12% | NA |
| Intermediate | 90 | 53.30% | 1.10% | 27.78% | 17.78% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0802219193 | T -> C | LOC_Os08g04510.1 | synonymous_variant ; p.Ala1583Ala; LOW | synonymous_codon | Average:10.806; most accessible tissue: Callus, score: 25.667 | N | N | N | N |
| vg0802219193 | T -> DEL | LOC_Os08g04510.1 | N | frameshift_variant | Average:10.806; most accessible tissue: Callus, score: 25.667 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0802219193 | NA | 5.72E-06 | mr1405_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0802219193 | NA | 7.44E-06 | mr1648_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0802219193 | NA | 2.97E-07 | mr1655_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0802219193 | NA | 6.06E-07 | mr1669_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0802219193 | NA | 4.13E-06 | mr1669_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0802219193 | NA | 8.38E-06 | mr1704_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0802219193 | 3.77E-06 | 3.77E-06 | mr1981_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |