\
| Variant ID: vg0802212244 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 2212244 |
| Reference Allele: T | Alternative Allele: G |
| Primary Allele: T | Secondary Allele: G |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.94, G: 0.06, others allele: 0.00, population size: 88. )
CTATGCATGTTTTGAATTTTAGGGTTGGTTCAGGTATTATAGCTAGCACGAAAAGATAATAAGGTATTCTCTTGTGGTGTAGATGAAGATGAAGATTAAG[T/G]
GTTTTACGTAAAATAAGATGGTATTAATGTATAATTAATTGAGTTTTAATTATTATAAATTTTAAAAATAGATTTATCTGATATTTTAGAACAACTTCCA
TGGAAGTTGTTCTAAAATATCAGATAAATCTATTTTTAAAATTTATAATAATTAAAACTCAATTAATTATACATTAATACCATCTTATTTTACGTAAAAC[A/C]
CTTAATCTTCATCTTCATCTACACCACAAGAGAATACCTTATTATCTTTTCGTGCTAGCTATAATACCTGAACCAACCCTAAAATTCAAAACATGCATAG
| Populations | Population Size | Frequency of T(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 62.10% | 36.00% | 0.83% | 0.99% | NA |
| All Indica | 2759 | 39.70% | 59.60% | 0.58% | 0.14% | NA |
| All Japonica | 1512 | 98.30% | 1.70% | 0.00% | 0.07% | NA |
| Aus | 269 | 74.30% | 1.50% | 8.55% | 15.61% | NA |
| Indica I | 595 | 39.30% | 60.00% | 0.67% | 0.00% | NA |
| Indica II | 465 | 16.60% | 83.20% | 0.22% | 0.00% | NA |
| Indica III | 913 | 43.70% | 56.10% | 0.22% | 0.00% | NA |
| Indica Intermediate | 786 | 49.10% | 49.20% | 1.15% | 0.51% | NA |
| Temperate Japonica | 767 | 98.30% | 1.70% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 98.60% | 1.20% | 0.00% | 0.20% | NA |
| Japonica Intermediate | 241 | 97.50% | 2.50% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 66.70% | 33.30% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0802212244 | T -> G | LOC_Os08g04490.1 | downstream_gene_variant ; 2555.0bp to feature; MODIFIER | silent_mutation | Average:41.44; most accessible tissue: Callus, score: 64.231 | N | N | N | N |
| vg0802212244 | T -> G | LOC_Os08g04500.1 | intron_variant ; MODIFIER | silent_mutation | Average:41.44; most accessible tissue: Callus, score: 64.231 | N | N | N | N |
| vg0802212244 | T -> G | LOC_Os08g04500.2 | intron_variant ; MODIFIER | silent_mutation | Average:41.44; most accessible tissue: Callus, score: 64.231 | N | N | N | N |
| vg0802212244 | T -> DEL | N | N | silent_mutation | Average:41.44; most accessible tissue: Callus, score: 64.231 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0802212244 | NA | 9.64E-06 | mr1011 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0802212244 | NA | 4.70E-14 | mr1183 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0802212244 | NA | 6.06E-09 | mr1352 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0802212244 | NA | 7.80E-14 | mr1503 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0802212244 | NA | 3.02E-07 | mr1593 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0802212244 | NA | 7.81E-11 | mr1720 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0802212244 | 6.09E-37 | 7.88E-30 | mr1739 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0802212244 | 7.67E-36 | 8.44E-65 | mr1739 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0802212244 | NA | 1.66E-20 | mr1183_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0802212244 | NA | 6.39E-07 | mr1268_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0802212244 | NA | 7.22E-09 | mr1319_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0802212244 | NA | 3.73E-19 | mr1352_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0802212244 | NA | 2.55E-14 | mr1720_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0802212244 | 3.58E-38 | 1.41E-30 | mr1739_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0802212244 | 3.14E-43 | 6.11E-75 | mr1739_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0802212244 | NA | 3.20E-09 | mr1751_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |