Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0802211662:

Variant ID: vg0802211662 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 2211662
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.79, G: 0.22, others allele: 0.00, population size: 204. )

Flanking Sequence (100 bp) in Reference Genome:

GGATTTCATGGTGGTCAGTACTTTCTTGTAGAAGAACTTCATGTAGCCTGGAAGTTCTTCAGCGGCTTCCTCATCCCATCTATTATATTTTTATGGTTCA[A/G]
TCATTGATAAAAATTAAATTCAAGTTAAAGACAAGAATTTTGGCTCCATGCAGCTTCTTTGAAACAAATTAAGTTCGGAATGAATTTCATTATTAAAAGA

Reverse complement sequence

TCTTTTAATAATGAAATTCATTCCGAACTTAATTTGTTTCAAAGAAGCTGCATGGAGCCAAAATTCTTGTCTTTAACTTGAATTTAATTTTTATCAATGA[T/C]
TGAACCATAAAAATATAATAGATGGGATGAGGAAGCCGCTGAAGAACTTCCAGGCTACATGAAGTTCTTCTACAAGAAAGTACTGACCACCATGAAATCC

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	58.30%	41.30%	0.15%	0.30%	NA
All Indica	2759	34.10%	65.20%	0.18%	0.47%	NA
All Japonica	1512	98.40%	1.60%	0.00%	0.00%	NA
Aus	269	65.40%	34.60%	0.00%	0.00%	NA
Indica I	595	39.50%	60.20%	0.00%	0.34%	NA
Indica II	465	15.50%	83.90%	0.43%	0.22%	NA
Indica III	913	31.10%	68.30%	0.33%	0.22%	NA
Indica Intermediate	786	44.50%	54.50%	0.00%	1.02%	NA
Temperate Japonica	767	98.30%	1.70%	0.00%	0.00%	NA
Tropical Japonica	504	99.00%	1.00%	0.00%	0.00%	NA
Japonica Intermediate	241	97.50%	2.50%	0.00%	0.00%	NA
VI/Aromatic	96	96.90%	3.10%	0.00%	0.00%	NA
Intermediate	90	61.10%	35.60%	2.22%	1.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0802211662	A -> G	LOC_Os08g04490.1	downstream_gene_variant ; 1973.0bp to feature; MODIFIER	silent_mutation	Average:47.005; most accessible tissue: Zhenshan97 young leaf, score: 59.009	N	N	N	N
vg0802211662	A -> G	LOC_Os08g04500.1	intron_variant ; MODIFIER	silent_mutation	Average:47.005; most accessible tissue: Zhenshan97 young leaf, score: 59.009	N	N	N	N
vg0802211662	A -> G	LOC_Os08g04500.2	intron_variant ; MODIFIER	silent_mutation	Average:47.005; most accessible tissue: Zhenshan97 young leaf, score: 59.009	N	N	N	N
vg0802211662	A -> DEL	N	N	silent_mutation	Average:47.005; most accessible tissue: Zhenshan97 young leaf, score: 59.009	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0802211662	NA	3.65E-07	mr1593	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0802211662	1.49E-33	3.26E-31	mr1739	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0802211662	9.72E-37	1.13E-65	mr1739	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0802211662	NA	1.10E-06	mr1268_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0802211662	1.94E-29	8.05E-27	mr1739_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0802211662	1.79E-43	6.86E-76	mr1739_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251