\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0802210642:

Variant ID: vg0802210642 (JBrowse)Variation Type: INDEL
Chromosome: chr08Position: 2210642
Reference Allele: AAlternative Allele: G,AACG
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AGTTAACTACTCCATTCGTCCTAAAATATAACAACTTAGAATCGGATGTGACATTTTCTATTTTTCAGATTCATATTACTAGAAAATGTCACATCCGAAC[A/G,AACG]
TAAGTTCTTATATTTTGGGGACAAAATAAGTAATTAATTAGCAGATACTATATAGAGCTTGTTTTTTTTTATTGATTCAATCATGTCTCTTCGGCTTATA

Reverse complement sequence

TATAAGCCGAAGAGACATGATTGAATCAATAAAAAAAAACAAGCTCTATATAGTATCTGCTAATTAATTACTTATTTTGTCCCCAAAATATAAGAACTTA[T/C,CGTT]
GTTCGGATGTGACATTTTCTAGTAATATGAATCTGAAAAATAGAAAATGTCACATCCGATTCTAAGTTGTTATATTTTAGGACGAATGGAGTAGTTAACT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 79.10% 18.70% 0.87% 1.06% AACG: 0.32%
All Indica  2759 67.30% 31.30% 0.65% 0.18% AACG: 0.54%
All Japonica  1512 99.70% 0.30% 0.00% 0.07% NA
Aus  269 75.10% 0.00% 8.55% 16.36% NA
Indica I  595 61.20% 38.70% 0.17% 0.00% NA
Indica II  465 85.80% 14.00% 0.22% 0.00% NA
Indica III  913 69.70% 28.10% 0.55% 0.00% AACG: 1.64%
Indica Intermediate  786 58.40% 39.60% 1.40% 0.64% NA
Temperate Japonica  767 99.70% 0.30% 0.00% 0.00% NA
Tropical Japonica  504 99.60% 0.20% 0.00% 0.20% NA
Japonica Intermediate  241 99.60% 0.40% 0.00% 0.00% NA
VI/Aromatic  96 95.80% 4.20% 0.00% 0.00% NA
Intermediate  90 87.80% 12.20% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0802210642 A -> G LOC_Os08g04490.1 downstream_gene_variant ; 953.0bp to feature; MODIFIER silent_mutation Average:39.425; most accessible tissue: Minghui63 panicle, score: 50.413 N N N N
vg0802210642 A -> G LOC_Os08g04500.1 intron_variant ; MODIFIER silent_mutation Average:39.425; most accessible tissue: Minghui63 panicle, score: 50.413 N N N N
vg0802210642 A -> G LOC_Os08g04500.2 intron_variant ; MODIFIER silent_mutation Average:39.425; most accessible tissue: Minghui63 panicle, score: 50.413 N N N N
vg0802210642 A -> AACG LOC_Os08g04490.1 downstream_gene_variant ; 954.0bp to feature; MODIFIER silent_mutation Average:39.425; most accessible tissue: Minghui63 panicle, score: 50.413 N N N N
vg0802210642 A -> AACG LOC_Os08g04500.1 intron_variant ; MODIFIER silent_mutation Average:39.425; most accessible tissue: Minghui63 panicle, score: 50.413 N N N N
vg0802210642 A -> AACG LOC_Os08g04500.2 intron_variant ; MODIFIER silent_mutation Average:39.425; most accessible tissue: Minghui63 panicle, score: 50.413 N N N N
vg0802210642 A -> DEL N N silent_mutation Average:39.425; most accessible tissue: Minghui63 panicle, score: 50.413 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0802210642 NA 2.60E-07 mr1593 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0802210642 1.19E-42 5.03E-67 mr1739 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0802210642 2.28E-36 1.33E-64 mr1739 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0802210642 NA 2.87E-06 mr1268_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0802210642 3.65E-46 1.39E-67 mr1739_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0802210642 5.72E-43 1.20E-75 mr1739_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251