\
| Variant ID: vg0802210642 (JBrowse) | Variation Type: INDEL |
| Chromosome: chr08 | Position: 2210642 |
| Reference Allele: A | Alternative Allele: G,AACG |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
AGTTAACTACTCCATTCGTCCTAAAATATAACAACTTAGAATCGGATGTGACATTTTCTATTTTTCAGATTCATATTACTAGAAAATGTCACATCCGAAC[A/G,AACG]
TAAGTTCTTATATTTTGGGGACAAAATAAGTAATTAATTAGCAGATACTATATAGAGCTTGTTTTTTTTTATTGATTCAATCATGTCTCTTCGGCTTATA
TATAAGCCGAAGAGACATGATTGAATCAATAAAAAAAAACAAGCTCTATATAGTATCTGCTAATTAATTACTTATTTTGTCCCCAAAATATAAGAACTTA[T/C,CGTT]
GTTCGGATGTGACATTTTCTAGTAATATGAATCTGAAAAATAGAAAATGTCACATCCGATTCTAAGTTGTTATATTTTAGGACGAATGGAGTAGTTAACT
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 79.10% | 18.70% | 0.87% | 1.06% | AACG: 0.32% |
| All Indica | 2759 | 67.30% | 31.30% | 0.65% | 0.18% | AACG: 0.54% |
| All Japonica | 1512 | 99.70% | 0.30% | 0.00% | 0.07% | NA |
| Aus | 269 | 75.10% | 0.00% | 8.55% | 16.36% | NA |
| Indica I | 595 | 61.20% | 38.70% | 0.17% | 0.00% | NA |
| Indica II | 465 | 85.80% | 14.00% | 0.22% | 0.00% | NA |
| Indica III | 913 | 69.70% | 28.10% | 0.55% | 0.00% | AACG: 1.64% |
| Indica Intermediate | 786 | 58.40% | 39.60% | 1.40% | 0.64% | NA |
| Temperate Japonica | 767 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.60% | 0.20% | 0.00% | 0.20% | NA |
| Japonica Intermediate | 241 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 95.80% | 4.20% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 87.80% | 12.20% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0802210642 | A -> G | LOC_Os08g04490.1 | downstream_gene_variant ; 953.0bp to feature; MODIFIER | silent_mutation | Average:39.425; most accessible tissue: Minghui63 panicle, score: 50.413 | N | N | N | N |
| vg0802210642 | A -> G | LOC_Os08g04500.1 | intron_variant ; MODIFIER | silent_mutation | Average:39.425; most accessible tissue: Minghui63 panicle, score: 50.413 | N | N | N | N |
| vg0802210642 | A -> G | LOC_Os08g04500.2 | intron_variant ; MODIFIER | silent_mutation | Average:39.425; most accessible tissue: Minghui63 panicle, score: 50.413 | N | N | N | N |
| vg0802210642 | A -> AACG | LOC_Os08g04490.1 | downstream_gene_variant ; 954.0bp to feature; MODIFIER | silent_mutation | Average:39.425; most accessible tissue: Minghui63 panicle, score: 50.413 | N | N | N | N |
| vg0802210642 | A -> AACG | LOC_Os08g04500.1 | intron_variant ; MODIFIER | silent_mutation | Average:39.425; most accessible tissue: Minghui63 panicle, score: 50.413 | N | N | N | N |
| vg0802210642 | A -> AACG | LOC_Os08g04500.2 | intron_variant ; MODIFIER | silent_mutation | Average:39.425; most accessible tissue: Minghui63 panicle, score: 50.413 | N | N | N | N |
| vg0802210642 | A -> DEL | N | N | silent_mutation | Average:39.425; most accessible tissue: Minghui63 panicle, score: 50.413 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0802210642 | NA | 2.60E-07 | mr1593 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0802210642 | 1.19E-42 | 5.03E-67 | mr1739 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0802210642 | 2.28E-36 | 1.33E-64 | mr1739 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0802210642 | NA | 2.87E-06 | mr1268_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0802210642 | 3.65E-46 | 1.39E-67 | mr1739_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0802210642 | 5.72E-43 | 1.20E-75 | mr1739_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |