\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0802168597:

Variant ID: vg0802168597 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 2168597
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 327. )

Flanking Sequence (100 bp) in Reference Genome:


ATATTTATAATCCATTGGAATTTGTTGGGAAACGATCTCGTTGCAGTTTATTATCACAAAAGCTAGCATGCGTGCATGCAGTGGTGCTTCTAGACAAGTA[G/A]
TTAAACTTTCACATGAATTGTGCAGCAAAACTGGGAATTGCAGGTTTATTTCGTTGTCTGATGATATGATGCGATCACGGGGAAATGATGAAAATTAGCT

Reverse complement sequence

AGCTAATTTTCATCATTTCCCCGTGATCGCATCATATCATCAGACAACGAAATAAACCTGCAATTCCCAGTTTTGCTGCACAATTCATGTGAAAGTTTAA[C/T]
TACTTGTCTAGAAGCACCACTGCATGCACGCATGCTAGCTTTTGTGATAATAAACTGCAACGAGATCGTTTCCCAACAAATTCCAATGGATTATAAATAT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 86.20% 12.00% 1.76% 0.00% NA
All Indica  2759 77.00% 20.00% 2.94% 0.00% NA
All Japonica  1512 99.80% 0.10% 0.07% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 69.20% 24.40% 6.39% 0.00% NA
Indica II  465 86.90% 12.50% 0.65% 0.00% NA
Indica III  913 79.80% 19.50% 0.66% 0.00% NA
Indica Intermediate  786 73.80% 21.90% 4.33% 0.00% NA
Temperate Japonica  767 99.70% 0.10% 0.13% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 99.60% 0.40% 0.00% 0.00% NA
VI/Aromatic  96 95.80% 4.20% 0.00% 0.00% NA
Intermediate  90 90.00% 8.90% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0802168597 G -> A LOC_Os08g04420.2 upstream_gene_variant ; 4578.0bp to feature; MODIFIER silent_mutation Average:67.879; most accessible tissue: Zhenshan97 flower, score: 85.053 N N N N
vg0802168597 G -> A LOC_Os08g04430.1 downstream_gene_variant ; 1801.0bp to feature; MODIFIER silent_mutation Average:67.879; most accessible tissue: Zhenshan97 flower, score: 85.053 N N N N
vg0802168597 G -> A LOC_Os08g04440.1 downstream_gene_variant ; 4794.0bp to feature; MODIFIER silent_mutation Average:67.879; most accessible tissue: Zhenshan97 flower, score: 85.053 N N N N
vg0802168597 G -> A LOC_Os08g04440.2 downstream_gene_variant ; 4794.0bp to feature; MODIFIER silent_mutation Average:67.879; most accessible tissue: Zhenshan97 flower, score: 85.053 N N N N
vg0802168597 G -> A LOC_Os08g04420-LOC_Os08g04430 intergenic_region ; MODIFIER silent_mutation Average:67.879; most accessible tissue: Zhenshan97 flower, score: 85.053 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0802168597 NA 2.61E-07 mr1593 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0802168597 1.40E-33 4.76E-58 mr1739 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0802168597 4.57E-29 8.86E-53 mr1739 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0802168597 1.60E-26 6.55E-44 mr1739_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0802168597 3.53E-24 4.17E-43 mr1739_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251