Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0802168597:

Variant ID: vg0802168597 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 2168597
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 327. )

Flanking Sequence (100 bp) in Reference Genome:

ATATTTATAATCCATTGGAATTTGTTGGGAAACGATCTCGTTGCAGTTTATTATCACAAAAGCTAGCATGCGTGCATGCAGTGGTGCTTCTAGACAAGTA[G/A]
TTAAACTTTCACATGAATTGTGCAGCAAAACTGGGAATTGCAGGTTTATTTCGTTGTCTGATGATATGATGCGATCACGGGGAAATGATGAAAATTAGCT

Reverse complement sequence

AGCTAATTTTCATCATTTCCCCGTGATCGCATCATATCATCAGACAACGAAATAAACCTGCAATTCCCAGTTTTGCTGCACAATTCATGTGAAAGTTTAA[C/T]
TACTTGTCTAGAAGCACCACTGCATGCACGCATGCTAGCTTTTGTGATAATAAACTGCAACGAGATCGTTTCCCAACAAATTCCAATGGATTATAAATAT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	86.20%	12.00%	1.76%	0.00%	NA
All Indica	2759	77.00%	20.00%	2.94%	0.00%	NA
All Japonica	1512	99.80%	0.10%	0.07%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	69.20%	24.40%	6.39%	0.00%	NA
Indica II	465	86.90%	12.50%	0.65%	0.00%	NA
Indica III	913	79.80%	19.50%	0.66%	0.00%	NA
Indica Intermediate	786	73.80%	21.90%	4.33%	0.00%	NA
Temperate Japonica	767	99.70%	0.10%	0.13%	0.00%	NA
Tropical Japonica	504	100.00%	0.00%	0.00%	0.00%	NA
Japonica Intermediate	241	99.60%	0.40%	0.00%	0.00%	NA
VI/Aromatic	96	95.80%	4.20%	0.00%	0.00%	NA
Intermediate	90	90.00%	8.90%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0802168597	G -> A	LOC_Os08g04420.2	upstream_gene_variant ; 4578.0bp to feature; MODIFIER	silent_mutation	Average:67.879; most accessible tissue: Zhenshan97 flower, score: 85.053	N	N	N	N
vg0802168597	G -> A	LOC_Os08g04430.1	downstream_gene_variant ; 1801.0bp to feature; MODIFIER	silent_mutation	Average:67.879; most accessible tissue: Zhenshan97 flower, score: 85.053	N	N	N	N
vg0802168597	G -> A	LOC_Os08g04440.1	downstream_gene_variant ; 4794.0bp to feature; MODIFIER	silent_mutation	Average:67.879; most accessible tissue: Zhenshan97 flower, score: 85.053	N	N	N	N
vg0802168597	G -> A	LOC_Os08g04440.2	downstream_gene_variant ; 4794.0bp to feature; MODIFIER	silent_mutation	Average:67.879; most accessible tissue: Zhenshan97 flower, score: 85.053	N	N	N	N
vg0802168597	G -> A	LOC_Os08g04420-LOC_Os08g04430	intergenic_region ; MODIFIER	silent_mutation	Average:67.879; most accessible tissue: Zhenshan97 flower, score: 85.053	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0802168597	NA	2.61E-07	mr1593	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0802168597	1.40E-33	4.76E-58	mr1739	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0802168597	4.57E-29	8.86E-53	mr1739	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0802168597	1.60E-26	6.55E-44	mr1739_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0802168597	3.53E-24	4.17E-43	mr1739_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251