\
| Variant ID: vg0802102126 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 2102126 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.91, T: 0.09, others allele: 0.00, population size: 213. )
AAAACAAACATGCGATCTAGCCTCATATATTATGTTTTTGTGAGACACTTTTTGGTACTATGTATTGGTTCTACTATGATGTATTGTACCCTATTTGTTT[T/C]
CTAAGGTCCTAATGGCCTAATATAATCGTATTATAGATATATAGAATGGTTAAATGGTTATTGTCTATGTGATATGTAAGATTGTTGCTTCGACTTGATA
TATCAAGTCGAAGCAACAATCTTACATATCACATAGACAATAACCATTTAACCATTCTATATATCTATAATACGATTATATTAGGCCATTAGGACCTTAG[A/G]
AAACAAATAGGGTACAATACATCATAGTAGAACCAATACATAGTACCAAAAAGTGTCTCACAAAAACATAATATATGAGGCTAGATCGCATGTTTGTTTT
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 63.70% | 36.10% | 0.21% | 0.02% | NA |
| All Indica | 2759 | 45.40% | 54.30% | 0.29% | 0.04% | NA |
| All Japonica | 1512 | 99.30% | 0.70% | 0.00% | 0.00% | NA |
| Aus | 269 | 38.70% | 61.00% | 0.37% | 0.00% | NA |
| Indica I | 595 | 67.90% | 31.80% | 0.34% | 0.00% | NA |
| Indica II | 465 | 75.10% | 24.70% | 0.22% | 0.00% | NA |
| Indica III | 913 | 17.10% | 82.80% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 43.60% | 55.70% | 0.51% | 0.13% | NA |
| Temperate Japonica | 767 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.40% | 0.60% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 98.30% | 1.70% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 93.80% | 6.20% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 70.00% | 28.90% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0802102126 | T -> C | LOC_Os08g04290.1 | downstream_gene_variant ; 1522.0bp to feature; MODIFIER | silent_mutation | Average:34.39; most accessible tissue: Minghui63 panicle, score: 42.799 | N | N | N | N |
| vg0802102126 | T -> C | LOC_Os08g04290-LOC_Os08g04300 | intergenic_region ; MODIFIER | silent_mutation | Average:34.39; most accessible tissue: Minghui63 panicle, score: 42.799 | N | N | N | N |
| vg0802102126 | T -> DEL | N | N | silent_mutation | Average:34.39; most accessible tissue: Minghui63 panicle, score: 42.799 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0802102126 | NA | 9.11E-06 | mr1195 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0802102126 | 9.52E-14 | 1.02E-23 | mr1739 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0802102126 | 4.48E-16 | 1.30E-27 | mr1739 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0802102126 | NA | 2.35E-06 | mr1740 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0802102126 | NA | 6.26E-06 | mr1751 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0802102126 | NA | 2.37E-06 | mr1051_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0802102126 | NA | 9.62E-06 | mr1483_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0802102126 | NA | 7.59E-06 | mr1536_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0802102126 | NA | 3.82E-11 | mr1654_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0802102126 | NA | 3.13E-06 | mr1654_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0802102126 | 1.41E-08 | 2.51E-19 | mr1739_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0802102126 | 1.15E-10 | 4.37E-21 | mr1739_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |