Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0802102126:

Variant ID: vg0802102126 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 2102126
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.91, T: 0.09, others allele: 0.00, population size: 213. )

Flanking Sequence (100 bp) in Reference Genome:

AAAACAAACATGCGATCTAGCCTCATATATTATGTTTTTGTGAGACACTTTTTGGTACTATGTATTGGTTCTACTATGATGTATTGTACCCTATTTGTTT[T/C]
CTAAGGTCCTAATGGCCTAATATAATCGTATTATAGATATATAGAATGGTTAAATGGTTATTGTCTATGTGATATGTAAGATTGTTGCTTCGACTTGATA

Reverse complement sequence

TATCAAGTCGAAGCAACAATCTTACATATCACATAGACAATAACCATTTAACCATTCTATATATCTATAATACGATTATATTAGGCCATTAGGACCTTAG[A/G]
AAACAAATAGGGTACAATACATCATAGTAGAACCAATACATAGTACCAAAAAGTGTCTCACAAAAACATAATATATGAGGCTAGATCGCATGTTTGTTTT

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	63.70%	36.10%	0.21%	0.02%	NA
All Indica	2759	45.40%	54.30%	0.29%	0.04%	NA
All Japonica	1512	99.30%	0.70%	0.00%	0.00%	NA
Aus	269	38.70%	61.00%	0.37%	0.00%	NA
Indica I	595	67.90%	31.80%	0.34%	0.00%	NA
Indica II	465	75.10%	24.70%	0.22%	0.00%	NA
Indica III	913	17.10%	82.80%	0.11%	0.00%	NA
Indica Intermediate	786	43.60%	55.70%	0.51%	0.13%	NA
Temperate Japonica	767	99.60%	0.40%	0.00%	0.00%	NA
Tropical Japonica	504	99.40%	0.60%	0.00%	0.00%	NA
Japonica Intermediate	241	98.30%	1.70%	0.00%	0.00%	NA
VI/Aromatic	96	93.80%	6.20%	0.00%	0.00%	NA
Intermediate	90	70.00%	28.90%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0802102126	T -> C	LOC_Os08g04290.1	downstream_gene_variant ; 1522.0bp to feature; MODIFIER	silent_mutation	Average:34.39; most accessible tissue: Minghui63 panicle, score: 42.799	N	N	N	N
vg0802102126	T -> C	LOC_Os08g04290-LOC_Os08g04300	intergenic_region ; MODIFIER	silent_mutation	Average:34.39; most accessible tissue: Minghui63 panicle, score: 42.799	N	N	N	N
vg0802102126	T -> DEL	N	N	silent_mutation	Average:34.39; most accessible tissue: Minghui63 panicle, score: 42.799	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0802102126	NA	9.11E-06	mr1195	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0802102126	9.52E-14	1.02E-23	mr1739	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0802102126	4.48E-16	1.30E-27	mr1739	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0802102126	NA	2.35E-06	mr1740	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0802102126	NA	6.26E-06	mr1751	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0802102126	NA	2.37E-06	mr1051_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0802102126	NA	9.62E-06	mr1483_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0802102126	NA	7.59E-06	mr1536_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0802102126	NA	3.82E-11	mr1654_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0802102126	NA	3.13E-06	mr1654_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0802102126	1.41E-08	2.51E-19	mr1739_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0802102126	1.15E-10	4.37E-21	mr1739_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251