\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0802102126:

Variant ID: vg0802102126 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 2102126
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.91, T: 0.09, others allele: 0.00, population size: 213. )

Flanking Sequence (100 bp) in Reference Genome:


AAAACAAACATGCGATCTAGCCTCATATATTATGTTTTTGTGAGACACTTTTTGGTACTATGTATTGGTTCTACTATGATGTATTGTACCCTATTTGTTT[T/C]
CTAAGGTCCTAATGGCCTAATATAATCGTATTATAGATATATAGAATGGTTAAATGGTTATTGTCTATGTGATATGTAAGATTGTTGCTTCGACTTGATA

Reverse complement sequence

TATCAAGTCGAAGCAACAATCTTACATATCACATAGACAATAACCATTTAACCATTCTATATATCTATAATACGATTATATTAGGCCATTAGGACCTTAG[A/G]
AAACAAATAGGGTACAATACATCATAGTAGAACCAATACATAGTACCAAAAAGTGTCTCACAAAAACATAATATATGAGGCTAGATCGCATGTTTGTTTT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 63.70% 36.10% 0.21% 0.02% NA
All Indica  2759 45.40% 54.30% 0.29% 0.04% NA
All Japonica  1512 99.30% 0.70% 0.00% 0.00% NA
Aus  269 38.70% 61.00% 0.37% 0.00% NA
Indica I  595 67.90% 31.80% 0.34% 0.00% NA
Indica II  465 75.10% 24.70% 0.22% 0.00% NA
Indica III  913 17.10% 82.80% 0.11% 0.00% NA
Indica Intermediate  786 43.60% 55.70% 0.51% 0.13% NA
Temperate Japonica  767 99.60% 0.40% 0.00% 0.00% NA
Tropical Japonica  504 99.40% 0.60% 0.00% 0.00% NA
Japonica Intermediate  241 98.30% 1.70% 0.00% 0.00% NA
VI/Aromatic  96 93.80% 6.20% 0.00% 0.00% NA
Intermediate  90 70.00% 28.90% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0802102126 T -> C LOC_Os08g04290.1 downstream_gene_variant ; 1522.0bp to feature; MODIFIER silent_mutation Average:34.39; most accessible tissue: Minghui63 panicle, score: 42.799 N N N N
vg0802102126 T -> C LOC_Os08g04290-LOC_Os08g04300 intergenic_region ; MODIFIER silent_mutation Average:34.39; most accessible tissue: Minghui63 panicle, score: 42.799 N N N N
vg0802102126 T -> DEL N N silent_mutation Average:34.39; most accessible tissue: Minghui63 panicle, score: 42.799 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0802102126 NA 9.11E-06 mr1195 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0802102126 9.52E-14 1.02E-23 mr1739 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0802102126 4.48E-16 1.30E-27 mr1739 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0802102126 NA 2.35E-06 mr1740 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0802102126 NA 6.26E-06 mr1751 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0802102126 NA 2.37E-06 mr1051_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0802102126 NA 9.62E-06 mr1483_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0802102126 NA 7.59E-06 mr1536_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0802102126 NA 3.82E-11 mr1654_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0802102126 NA 3.13E-06 mr1654_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0802102126 1.41E-08 2.51E-19 mr1739_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0802102126 1.15E-10 4.37E-21 mr1739_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251