Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0802078087:

Variant ID: vg0802078087 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 2078087
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTCTTTATCAGGTTATAAATTTTCTAAGACATTTGTGCCACTTGGCATGAATCTAATTTAACATTCTTTCTTTATCAGGTTATAAATTGAAACCATTGAA[T/C]
GTACTTTGTCTTCCCGTCTCTAAAACATTGTGATATATCTATAATATTTTAATATTTTTAAGTTTAAAAATAATTTAGACTAATAATATAGATATTTAAA

Reverse complement sequence

TTTAAATATCTATATTATTAGTCTAAATTATTTTTAAACTTAAAAATATTAAAATATTATAGATATATCACAATGTTTTAGAGACGGGAAGACAAAGTAC[A/G]
TTCAATGGTTTCAATTTATAACCTGATAAAGAAAGAATGTTAAATTAGATTCATGCCAAGTGGCACAAATGTCTTAGAAAATTTATAACCTGATAAAGAA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 65.30% 34.40% 0.19% 0.17% NA
All Indica  2759 98.60% 1.00% 0.22% 0.25% NA
All Japonica  1512 2.30% 97.60% 0.07% 0.00% NA
Aus  269 98.90% 1.10% 0.00% 0.00% NA
Indica I  595 98.50% 0.30% 0.84% 0.34% NA
Indica II  465 98.70% 0.90% 0.00% 0.43% NA
Indica III  913 99.10% 0.90% 0.00% 0.00% NA
Indica Intermediate  786 97.80% 1.70% 0.13% 0.38% NA
Temperate Japonica  767 2.10% 97.90% 0.00% 0.00% NA
Tropical Japonica  504 1.40% 98.40% 0.20% 0.00% NA
Japonica Intermediate  241 5.00% 95.00% 0.00% 0.00% NA
VI/Aromatic  96 15.60% 83.30% 1.04% 0.00% NA
Intermediate  90 54.40% 43.30% 1.11% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0802078087 T -> C LOC_Os08g04260.1 downstream_gene_variant ; 4766.0bp to feature; MODIFIER silent_mutation Average:29.565; most accessible tissue: Zhenshan97 panicle, score: 52.263 N N N N
vg0802078087 T -> C LOC_Os08g04270.1 intron_variant ; MODIFIER silent_mutation Average:29.565; most accessible tissue: Zhenshan97 panicle, score: 52.263 N N N N
vg0802078087 T -> C LOC_Os08g04270.2 intron_variant ; MODIFIER silent_mutation Average:29.565; most accessible tissue: Zhenshan97 panicle, score: 52.263 N N N N
vg0802078087 T -> C LOC_Os08g04270.3 intron_variant ; MODIFIER silent_mutation Average:29.565; most accessible tissue: Zhenshan97 panicle, score: 52.263 N N N N
vg0802078087 T -> DEL N N silent_mutation Average:29.565; most accessible tissue: Zhenshan97 panicle, score: 52.263 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0802078087 NA 1.15E-08 mr1005 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0802078087 NA 3.94E-104 mr1008 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0802078087 NA 8.64E-103 mr1009 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0802078087 NA 6.61E-73 mr1027 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0802078087 NA 3.03E-31 mr1074 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0802078087 NA 1.57E-33 mr1081 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0802078087 NA 5.80E-23 mr1122 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0802078087 NA 1.29E-25 mr1130 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0802078087 NA 3.10E-76 mr1135 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0802078087 NA 1.80E-43 mr1152 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0802078087 NA 4.60E-12 mr1170 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0802078087 NA 1.71E-47 mr1194 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0802078087 NA 2.41E-29 mr1256 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0802078087 NA 2.09E-23 mr1383 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0802078087 NA 2.00E-28 mr1414 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0802078087 NA 2.08E-90 mr1504 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0802078087 NA 1.23E-88 mr1517 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0802078087 NA 2.11E-37 mr1542 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0802078087 NA 7.28E-43 mr1591 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0802078087 NA 1.40E-58 mr1594 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0802078087 NA 2.94E-73 mr1629 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0802078087 NA 1.30E-26 mr1632 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0802078087 NA 1.13E-12 mr1641 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0802078087 NA 5.11E-35 mr1670 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0802078087 NA 4.23E-86 mr1672 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0802078087 NA 6.94E-11 mr1683 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0802078087 NA 2.73E-60 mr1695 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0802078087 NA 1.17E-27 mr1723 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0802078087 NA 3.37E-96 mr1758 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0802078087 NA 7.94E-18 mr1767 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0802078087 NA 4.51E-09 mr1776 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0802078087 NA 1.80E-22 mr1838 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0802078087 NA 9.54E-72 mr1865 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0802078087 NA 1.17E-41 mr1873 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0802078087 NA 1.59E-39 mr1882 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0802078087 NA 1.31E-53 mr1889 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0802078087 NA 1.14E-68 mr1896 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0802078087 NA 1.58E-77 mr1907 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0802078087 NA 3.99E-14 mr1924 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0802078087 NA 7.57E-18 mr1968 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0802078087 NA 8.23E-09 mr1986 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0802078087 NA 2.20E-103 mr1987 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0802078087 NA 8.74E-18 mr1336_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0802078087 NA 1.83E-14 mr1579_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0802078087 NA 6.14E-58 mr1695_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0802078087 NA 3.89E-23 mr1708_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0802078087 NA 6.34E-15 mr1767_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0802078087 NA 5.01E-88 mr1795_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0802078087 NA 3.34E-30 mr1891_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0802078087 NA 2.47E-40 mr1944_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0802078087 NA 1.81E-18 mr1945_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251