Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0802074891:

Variant ID: vg0802074891 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 2074891
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 286. )

Flanking Sequence (100 bp) in Reference Genome:

AATTAGGTACAAATTAGTCCATGACGCGTGGGGCCAGGTGGTTAAATACCTATTAAAAATTAGATTAAACATACACTGTCTATGACATTTGGGACCCACT[G/A]
GTGTTTAAAGAAGGAAAGAGAAGGGGCAATCTGGGCATTTAGAAAAATATCTCACCTCTTTTGAACCAGAAATAAGAAAATAATGCAACCAGTGTTCTAT

Reverse complement sequence

ATAGAACACTGGTTGCATTATTTTCTTATTTCTGGTTCAAAAGAGGTGAGATATTTTTCTAAATGCCCAGATTGCCCCTTCTCTTTCCTTCTTTAAACAC[C/T]
AGTGGGTCCCAAATGTCATAGACAGTGTATGTTTAATCTAATTTTTAATAGGTATTTAACCACCTGGCCCCACGCGTCATGGACTAATTTGTACCTAATT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	94.50%	5.30%	0.19%	0.00%	NA
All Indica	2759	99.90%	0.10%	0.04%	0.00%	NA
All Japonica	1512	83.50%	16.00%	0.53%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	99.80%	0.20%	0.00%	0.00%	NA
Indica III	913	100.00%	0.00%	0.00%	0.00%	NA
Indica Intermediate	786	99.70%	0.10%	0.13%	0.00%	NA
Temperate Japonica	767	99.70%	0.10%	0.13%	0.00%	NA
Tropical Japonica	504	51.60%	47.40%	0.99%	0.00%	NA
Japonica Intermediate	241	98.30%	0.80%	0.83%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	93.30%	6.70%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0802074891	G -> A	LOC_Os08g04270.1	upstream_gene_variant ; 2343.0bp to feature; MODIFIER	silent_mutation	Average:33.481; most accessible tissue: Minghui63 panicle, score: 64.459	N	N	N	N
vg0802074891	G -> A	LOC_Os08g04270.2	upstream_gene_variant ; 2343.0bp to feature; MODIFIER	silent_mutation	Average:33.481; most accessible tissue: Minghui63 panicle, score: 64.459	N	N	N	N
vg0802074891	G -> A	LOC_Os08g04270.3	upstream_gene_variant ; 2343.0bp to feature; MODIFIER	silent_mutation	Average:33.481; most accessible tissue: Minghui63 panicle, score: 64.459	N	N	N	N
vg0802074891	G -> A	LOC_Os08g04260.1	downstream_gene_variant ; 1570.0bp to feature; MODIFIER	silent_mutation	Average:33.481; most accessible tissue: Minghui63 panicle, score: 64.459	N	N	N	N
vg0802074891	G -> A	LOC_Os08g04260-LOC_Os08g04270	intergenic_region ; MODIFIER	silent_mutation	Average:33.481; most accessible tissue: Minghui63 panicle, score: 64.459	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0802074891	8.76E-06	1.11E-09	mr1076	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0802074891	NA	8.80E-10	mr1082	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0802074891	6.35E-07	2.19E-11	mr1083	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0802074891	NA	9.14E-07	mr1103	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0802074891	3.93E-07	3.93E-07	mr1204	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0802074891	NA	3.38E-10	mr1226	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0802074891	NA	7.86E-06	mr1408	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0802074891	NA	2.12E-06	mr1560	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0802074891	NA	1.80E-06	mr1949	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0802074891	9.69E-07	9.69E-07	mr1076_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0802074891	NA	3.66E-09	mr1082_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0802074891	NA	1.17E-06	mr1083_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0802074891	NA	1.57E-06	mr1103_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0802074891	NA	7.54E-06	mr1104_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0802074891	NA	4.61E-07	mr1107_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0802074891	2.74E-06	2.44E-11	mr1226_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251