\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0802074891:

Variant ID: vg0802074891 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 2074891
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 286. )

Flanking Sequence (100 bp) in Reference Genome:


AATTAGGTACAAATTAGTCCATGACGCGTGGGGCCAGGTGGTTAAATACCTATTAAAAATTAGATTAAACATACACTGTCTATGACATTTGGGACCCACT[G/A]
GTGTTTAAAGAAGGAAAGAGAAGGGGCAATCTGGGCATTTAGAAAAATATCTCACCTCTTTTGAACCAGAAATAAGAAAATAATGCAACCAGTGTTCTAT

Reverse complement sequence

ATAGAACACTGGTTGCATTATTTTCTTATTTCTGGTTCAAAAGAGGTGAGATATTTTTCTAAATGCCCAGATTGCCCCTTCTCTTTCCTTCTTTAAACAC[C/T]
AGTGGGTCCCAAATGTCATAGACAGTGTATGTTTAATCTAATTTTTAATAGGTATTTAACCACCTGGCCCCACGCGTCATGGACTAATTTGTACCTAATT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 94.50% 5.30% 0.19% 0.00% NA
All Indica  2759 99.90% 0.10% 0.04% 0.00% NA
All Japonica  1512 83.50% 16.00% 0.53% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 99.80% 0.20% 0.00% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 99.70% 0.10% 0.13% 0.00% NA
Temperate Japonica  767 99.70% 0.10% 0.13% 0.00% NA
Tropical Japonica  504 51.60% 47.40% 0.99% 0.00% NA
Japonica Intermediate  241 98.30% 0.80% 0.83% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 93.30% 6.70% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0802074891 G -> A LOC_Os08g04270.1 upstream_gene_variant ; 2343.0bp to feature; MODIFIER silent_mutation Average:33.481; most accessible tissue: Minghui63 panicle, score: 64.459 N N N N
vg0802074891 G -> A LOC_Os08g04270.2 upstream_gene_variant ; 2343.0bp to feature; MODIFIER silent_mutation Average:33.481; most accessible tissue: Minghui63 panicle, score: 64.459 N N N N
vg0802074891 G -> A LOC_Os08g04270.3 upstream_gene_variant ; 2343.0bp to feature; MODIFIER silent_mutation Average:33.481; most accessible tissue: Minghui63 panicle, score: 64.459 N N N N
vg0802074891 G -> A LOC_Os08g04260.1 downstream_gene_variant ; 1570.0bp to feature; MODIFIER silent_mutation Average:33.481; most accessible tissue: Minghui63 panicle, score: 64.459 N N N N
vg0802074891 G -> A LOC_Os08g04260-LOC_Os08g04270 intergenic_region ; MODIFIER silent_mutation Average:33.481; most accessible tissue: Minghui63 panicle, score: 64.459 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0802074891 8.76E-06 1.11E-09 mr1076 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0802074891 NA 8.80E-10 mr1082 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0802074891 6.35E-07 2.19E-11 mr1083 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0802074891 NA 9.14E-07 mr1103 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0802074891 3.93E-07 3.93E-07 mr1204 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0802074891 NA 3.38E-10 mr1226 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0802074891 NA 7.86E-06 mr1408 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0802074891 NA 2.12E-06 mr1560 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0802074891 NA 1.80E-06 mr1949 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0802074891 9.69E-07 9.69E-07 mr1076_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0802074891 NA 3.66E-09 mr1082_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0802074891 NA 1.17E-06 mr1083_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0802074891 NA 1.57E-06 mr1103_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0802074891 NA 7.54E-06 mr1104_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0802074891 NA 4.61E-07 mr1107_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0802074891 2.74E-06 2.44E-11 mr1226_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251