\
| Variant ID: vg0802071791 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 2071791 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 300. )
ATTTTCATGACTATTGTTTGAAATTTAAAACCACGATGTTTAAATCATGCTTACTGCTTTGAAATATATGTATACGGTGGTAAAAAAAATATGAAAAATG[T/C]
TGAGAGGTAGGTTATAATGTATCTATATATCAATCCTACCAAATTTGCTTGCAAAATACGACGTATATAGTTGTATATCTTTATCTACTTAAAACATTCA
TGAATGTTTTAAGTAGATAAAGATATACAACTATATACGTCGTATTTTGCAAGCAAATTTGGTAGGATTGATATATAGATACATTATAACCTACCTCTCA[A/G]
CATTTTTCATATTTTTTTTACCACCGTATACATATATTTCAAAGCAGTAAGCATGATTTAAACATCGTGGTTTTAAATTTCAAACAATAGTCATGAAAAT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 90.30% | 6.80% | 2.90% | 0.00% | NA |
| All Indica | 2759 | 99.90% | 0.10% | 0.04% | 0.00% | NA |
| All Japonica | 1512 | 70.40% | 20.70% | 8.86% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.60% | 0.20% | 0.22% | 0.00% | NA |
| Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 48.00% | 36.80% | 15.25% | 0.00% | NA |
| Tropical Japonica | 504 | 98.00% | 1.40% | 0.60% | 0.00% | NA |
| Japonica Intermediate | 241 | 84.20% | 10.00% | 5.81% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 91.10% | 6.70% | 2.22% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0802071791 | T -> C | LOC_Os08g04260.1 | upstream_gene_variant ; 749.0bp to feature; MODIFIER | silent_mutation | Average:27.515; most accessible tissue: Minghui63 panicle, score: 46.754 | N | N | N | N |
| vg0802071791 | T -> C | LOC_Os08g04250.1 | downstream_gene_variant ; 4011.0bp to feature; MODIFIER | silent_mutation | Average:27.515; most accessible tissue: Minghui63 panicle, score: 46.754 | N | N | N | N |
| vg0802071791 | T -> C | LOC_Os08g04250-LOC_Os08g04260 | intergenic_region ; MODIFIER | silent_mutation | Average:27.515; most accessible tissue: Minghui63 panicle, score: 46.754 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0802071791 | NA | 6.90E-08 | mr1163 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0802071791 | NA | 7.86E-06 | mr1548 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0802071791 | NA | 1.85E-06 | mr1627 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0802071791 | NA | 2.27E-09 | mr1977 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0802071791 | NA | 7.40E-06 | mr1977 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0802071791 | NA | 3.26E-08 | mr1010_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0802071791 | NA | 3.28E-06 | mr1627_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0802071791 | 1.88E-06 | 7.05E-09 | mr1977_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0802071791 | NA | 3.39E-06 | mr1977_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |