\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0802071791:

Variant ID: vg0802071791 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 2071791
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 300. )

Flanking Sequence (100 bp) in Reference Genome:


ATTTTCATGACTATTGTTTGAAATTTAAAACCACGATGTTTAAATCATGCTTACTGCTTTGAAATATATGTATACGGTGGTAAAAAAAATATGAAAAATG[T/C]
TGAGAGGTAGGTTATAATGTATCTATATATCAATCCTACCAAATTTGCTTGCAAAATACGACGTATATAGTTGTATATCTTTATCTACTTAAAACATTCA

Reverse complement sequence

TGAATGTTTTAAGTAGATAAAGATATACAACTATATACGTCGTATTTTGCAAGCAAATTTGGTAGGATTGATATATAGATACATTATAACCTACCTCTCA[A/G]
CATTTTTCATATTTTTTTTACCACCGTATACATATATTTCAAAGCAGTAAGCATGATTTAAACATCGTGGTTTTAAATTTCAAACAATAGTCATGAAAAT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 90.30% 6.80% 2.90% 0.00% NA
All Indica  2759 99.90% 0.10% 0.04% 0.00% NA
All Japonica  1512 70.40% 20.70% 8.86% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 99.60% 0.20% 0.22% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 99.90% 0.10% 0.00% 0.00% NA
Temperate Japonica  767 48.00% 36.80% 15.25% 0.00% NA
Tropical Japonica  504 98.00% 1.40% 0.60% 0.00% NA
Japonica Intermediate  241 84.20% 10.00% 5.81% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 91.10% 6.70% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0802071791 T -> C LOC_Os08g04260.1 upstream_gene_variant ; 749.0bp to feature; MODIFIER silent_mutation Average:27.515; most accessible tissue: Minghui63 panicle, score: 46.754 N N N N
vg0802071791 T -> C LOC_Os08g04250.1 downstream_gene_variant ; 4011.0bp to feature; MODIFIER silent_mutation Average:27.515; most accessible tissue: Minghui63 panicle, score: 46.754 N N N N
vg0802071791 T -> C LOC_Os08g04250-LOC_Os08g04260 intergenic_region ; MODIFIER silent_mutation Average:27.515; most accessible tissue: Minghui63 panicle, score: 46.754 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0802071791 NA 6.90E-08 mr1163 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0802071791 NA 7.86E-06 mr1548 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0802071791 NA 1.85E-06 mr1627 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0802071791 NA 2.27E-09 mr1977 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0802071791 NA 7.40E-06 mr1977 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0802071791 NA 3.26E-08 mr1010_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0802071791 NA 3.28E-06 mr1627_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0802071791 1.88E-06 7.05E-09 mr1977_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0802071791 NA 3.39E-06 mr1977_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251