Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0802068171:

Variant ID: vg0802068171 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 2068171
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

AGTACTCAGGACCTACTCCCCCCATCACATAAAAAAACAACCTATAGAATAAAATGTGATAGTACAATAAATCTAGCCAGGAATATGGGACAGAGAGAGT[A/G]
CGTGGGATCCATCCATGGATGTGAATATAGAGGTGAAGGTGGAGGTGGAGGTGAATGAGAATGTTTGTTGTTGTGTTAGAATGTGAATGCCAGATTCGCA

Reverse complement sequence

TGCGAATCTGGCATTCACATTCTAACACAACAACAAACATTCTCATTCACCTCCACCTCCACCTTCACCTCTATATTCACATCCATGGATGGATCCCACG[T/C]
ACTCTCTCTGTCCCATATTCCTGGCTAGATTTATTGTACTATCACATTTTATTCTATAGGTTGTTTTTTTATGTGATGGGGGGAGTAGGTCCTGAGTACT

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	68.90%	4.20%	2.69%	24.25%	NA
All Indica	2759	48.20%	7.00%	4.46%	40.34%	NA
All Japonica	1512	98.70%	0.10%	0.13%	1.12%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	11.10%	15.10%	11.60%	62.18%	NA
Indica II	465	21.30%	5.80%	4.30%	68.60%	NA
Indica III	913	84.30%	1.10%	0.77%	13.80%	NA
Indica Intermediate	786	50.10%	8.50%	3.44%	37.91%	NA
Temperate Japonica	767	98.60%	0.00%	0.13%	1.30%	NA
Tropical Japonica	504	99.20%	0.00%	0.20%	0.60%	NA
Japonica Intermediate	241	97.90%	0.40%	0.00%	1.66%	NA
VI/Aromatic	96	99.00%	0.00%	0.00%	1.04%	NA
Intermediate	90	77.80%	3.30%	2.22%	16.67%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0802068171	A -> G	LOC_Os08g04240.1	upstream_gene_variant ; 3262.0bp to feature; MODIFIER	silent_mutation	Average:24.163; most accessible tissue: Callus, score: 89.697	N	N	N	N
vg0802068171	A -> G	LOC_Os08g04260.1	upstream_gene_variant ; 4369.0bp to feature; MODIFIER	silent_mutation	Average:24.163; most accessible tissue: Callus, score: 89.697	N	N	N	N
vg0802068171	A -> G	LOC_Os08g04250.1	downstream_gene_variant ; 391.0bp to feature; MODIFIER	silent_mutation	Average:24.163; most accessible tissue: Callus, score: 89.697	N	N	N	N
vg0802068171	A -> G	LOC_Os08g04250-LOC_Os08g04260	intergenic_region ; MODIFIER	silent_mutation	Average:24.163; most accessible tissue: Callus, score: 89.697	N	N	N	N
vg0802068171	A -> DEL	N	N	silent_mutation	Average:24.163; most accessible tissue: Callus, score: 89.697	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0802068171	NA	1.52E-06	mr1593	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0802068171	1.84E-09	1.18E-16	mr1739	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0802068171	9.06E-09	5.90E-14	mr1739	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0802068171	1.62E-09	2.05E-14	mr1739_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0802068171	1.44E-08	7.18E-12	mr1739_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251