Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0802058938:

Variant ID: vg0802058938 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 2058938
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, A: 0.00, others allele: 0.00, population size: 331. )

Flanking Sequence (100 bp) in Reference Genome:

GCTTGCACACTTGAGAGCGGGCGCAACATCGGTGGTGGAACTGTCCTCACAGCACATTGGTGGAGGCCAAGGCGAAAGCATGGACGCTACGGGCATCGTC[G/A]
TTTACTCGTTGGAGGCGTCCTTTTTGTCTCCTCGTCATGCCGTGTTTGGATTTTGTGGGTGTAAACCTAGCCCAAGATGATGGTGGCGTATAGCTTGACG

Reverse complement sequence

CGTCAAGCTATACGCCACCATCATCTTGGGCTAGGTTTACACCCACAAAATCCAAACACGGCATGACGAGGAGACAAAAAGGACGCCTCCAACGAGTAAA[C/T]
GACGATGCCCGTAGCGTCCATGCTTTCGCCTTGGCCTCCACCAATGTGCTGTGAGGACAGTTCCACCACCGATGTTGCGCCCGCTCTCAAGTGTGCAAGC

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	95.70%	3.70%	0.06%	0.53%	NA
All Indica	2759	99.00%	0.60%	0.00%	0.40%	NA
All Japonica	1512	99.90%	0.10%	0.00%	0.00%	NA
Aus	269	42.40%	57.60%	0.00%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	98.70%	0.20%	0.00%	1.08%	NA
Indica III	913	98.60%	1.00%	0.00%	0.44%	NA
Indica Intermediate	786	98.90%	0.90%	0.00%	0.25%	NA
Temperate Japonica	767	100.00%	0.00%	0.00%	0.00%	NA
Tropical Japonica	504	99.80%	0.20%	0.00%	0.00%	NA
Japonica Intermediate	241	100.00%	0.00%	0.00%	0.00%	NA
VI/Aromatic	96	80.20%	2.10%	3.12%	14.58%	NA
Intermediate	90	97.80%	2.20%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0802058938	G -> A	LOC_Os08g04210.1	upstream_gene_variant ; 2913.0bp to feature; MODIFIER	silent_mutation	Average:58.595; most accessible tissue: Zhenshan97 young leaf, score: 84.431	N	N	N	N
vg0802058938	G -> A	LOC_Os08g04220.1	downstream_gene_variant ; 184.0bp to feature; MODIFIER	silent_mutation	Average:58.595; most accessible tissue: Zhenshan97 young leaf, score: 84.431	N	N	N	N
vg0802058938	G -> A	LOC_Os08g04230.1	downstream_gene_variant ; 713.0bp to feature; MODIFIER	silent_mutation	Average:58.595; most accessible tissue: Zhenshan97 young leaf, score: 84.431	N	N	N	N
vg0802058938	G -> A	LOC_Os08g04240.1	downstream_gene_variant ; 4218.0bp to feature; MODIFIER	silent_mutation	Average:58.595; most accessible tissue: Zhenshan97 young leaf, score: 84.431	N	N	N	N
vg0802058938	G -> A	LOC_Os08g04220-LOC_Os08g04230	intergenic_region ; MODIFIER	silent_mutation	Average:58.595; most accessible tissue: Zhenshan97 young leaf, score: 84.431	N	N	N	N
vg0802058938	G -> DEL	N	N	silent_mutation	Average:58.595; most accessible tissue: Zhenshan97 young leaf, score: 84.431	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0802058938	4.17E-06	NA	mr1118	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0802058938	9.51E-09	NA	mr1123	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0802058938	NA	8.86E-07	mr1230	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0802058938	1.10E-06	NA	mr1242	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0802058938	1.27E-07	NA	mr1496	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0802058938	NA	3.72E-19	mr1515	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0802058938	NA	5.15E-07	mr1582_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251