\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0802058938:

Variant ID: vg0802058938 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 2058938
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, A: 0.00, others allele: 0.00, population size: 331. )

Flanking Sequence (100 bp) in Reference Genome:


GCTTGCACACTTGAGAGCGGGCGCAACATCGGTGGTGGAACTGTCCTCACAGCACATTGGTGGAGGCCAAGGCGAAAGCATGGACGCTACGGGCATCGTC[G/A]
TTTACTCGTTGGAGGCGTCCTTTTTGTCTCCTCGTCATGCCGTGTTTGGATTTTGTGGGTGTAAACCTAGCCCAAGATGATGGTGGCGTATAGCTTGACG

Reverse complement sequence

CGTCAAGCTATACGCCACCATCATCTTGGGCTAGGTTTACACCCACAAAATCCAAACACGGCATGACGAGGAGACAAAAAGGACGCCTCCAACGAGTAAA[C/T]
GACGATGCCCGTAGCGTCCATGCTTTCGCCTTGGCCTCCACCAATGTGCTGTGAGGACAGTTCCACCACCGATGTTGCGCCCGCTCTCAAGTGTGCAAGC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 95.70% 3.70% 0.06% 0.53% NA
All Indica  2759 99.00% 0.60% 0.00% 0.40% NA
All Japonica  1512 99.90% 0.10% 0.00% 0.00% NA
Aus  269 42.40% 57.60% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 98.70% 0.20% 0.00% 1.08% NA
Indica III  913 98.60% 1.00% 0.00% 0.44% NA
Indica Intermediate  786 98.90% 0.90% 0.00% 0.25% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 99.80% 0.20% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 80.20% 2.10% 3.12% 14.58% NA
Intermediate  90 97.80% 2.20% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0802058938 G -> A LOC_Os08g04210.1 upstream_gene_variant ; 2913.0bp to feature; MODIFIER silent_mutation Average:58.595; most accessible tissue: Zhenshan97 young leaf, score: 84.431 N N N N
vg0802058938 G -> A LOC_Os08g04220.1 downstream_gene_variant ; 184.0bp to feature; MODIFIER silent_mutation Average:58.595; most accessible tissue: Zhenshan97 young leaf, score: 84.431 N N N N
vg0802058938 G -> A LOC_Os08g04230.1 downstream_gene_variant ; 713.0bp to feature; MODIFIER silent_mutation Average:58.595; most accessible tissue: Zhenshan97 young leaf, score: 84.431 N N N N
vg0802058938 G -> A LOC_Os08g04240.1 downstream_gene_variant ; 4218.0bp to feature; MODIFIER silent_mutation Average:58.595; most accessible tissue: Zhenshan97 young leaf, score: 84.431 N N N N
vg0802058938 G -> A LOC_Os08g04220-LOC_Os08g04230 intergenic_region ; MODIFIER silent_mutation Average:58.595; most accessible tissue: Zhenshan97 young leaf, score: 84.431 N N N N
vg0802058938 G -> DEL N N silent_mutation Average:58.595; most accessible tissue: Zhenshan97 young leaf, score: 84.431 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0802058938 4.17E-06 NA mr1118 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0802058938 9.51E-09 NA mr1123 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0802058938 NA 8.86E-07 mr1230 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0802058938 1.10E-06 NA mr1242 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0802058938 1.27E-07 NA mr1496 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0802058938 NA 3.72E-19 mr1515 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0802058938 NA 5.15E-07 mr1582_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251