\
| Variant ID: vg0802058938 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 2058938 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, A: 0.00, others allele: 0.00, population size: 331. )
GCTTGCACACTTGAGAGCGGGCGCAACATCGGTGGTGGAACTGTCCTCACAGCACATTGGTGGAGGCCAAGGCGAAAGCATGGACGCTACGGGCATCGTC[G/A]
TTTACTCGTTGGAGGCGTCCTTTTTGTCTCCTCGTCATGCCGTGTTTGGATTTTGTGGGTGTAAACCTAGCCCAAGATGATGGTGGCGTATAGCTTGACG
CGTCAAGCTATACGCCACCATCATCTTGGGCTAGGTTTACACCCACAAAATCCAAACACGGCATGACGAGGAGACAAAAAGGACGCCTCCAACGAGTAAA[C/T]
GACGATGCCCGTAGCGTCCATGCTTTCGCCTTGGCCTCCACCAATGTGCTGTGAGGACAGTTCCACCACCGATGTTGCGCCCGCTCTCAAGTGTGCAAGC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 95.70% | 3.70% | 0.06% | 0.53% | NA |
| All Indica | 2759 | 99.00% | 0.60% | 0.00% | 0.40% | NA |
| All Japonica | 1512 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Aus | 269 | 42.40% | 57.60% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 98.70% | 0.20% | 0.00% | 1.08% | NA |
| Indica III | 913 | 98.60% | 1.00% | 0.00% | 0.44% | NA |
| Indica Intermediate | 786 | 98.90% | 0.90% | 0.00% | 0.25% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 80.20% | 2.10% | 3.12% | 14.58% | NA |
| Intermediate | 90 | 97.80% | 2.20% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0802058938 | G -> A | LOC_Os08g04210.1 | upstream_gene_variant ; 2913.0bp to feature; MODIFIER | silent_mutation | Average:58.595; most accessible tissue: Zhenshan97 young leaf, score: 84.431 | N | N | N | N |
| vg0802058938 | G -> A | LOC_Os08g04220.1 | downstream_gene_variant ; 184.0bp to feature; MODIFIER | silent_mutation | Average:58.595; most accessible tissue: Zhenshan97 young leaf, score: 84.431 | N | N | N | N |
| vg0802058938 | G -> A | LOC_Os08g04230.1 | downstream_gene_variant ; 713.0bp to feature; MODIFIER | silent_mutation | Average:58.595; most accessible tissue: Zhenshan97 young leaf, score: 84.431 | N | N | N | N |
| vg0802058938 | G -> A | LOC_Os08g04240.1 | downstream_gene_variant ; 4218.0bp to feature; MODIFIER | silent_mutation | Average:58.595; most accessible tissue: Zhenshan97 young leaf, score: 84.431 | N | N | N | N |
| vg0802058938 | G -> A | LOC_Os08g04220-LOC_Os08g04230 | intergenic_region ; MODIFIER | silent_mutation | Average:58.595; most accessible tissue: Zhenshan97 young leaf, score: 84.431 | N | N | N | N |
| vg0802058938 | G -> DEL | N | N | silent_mutation | Average:58.595; most accessible tissue: Zhenshan97 young leaf, score: 84.431 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0802058938 | 4.17E-06 | NA | mr1118 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0802058938 | 9.51E-09 | NA | mr1123 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0802058938 | NA | 8.86E-07 | mr1230 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0802058938 | 1.10E-06 | NA | mr1242 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0802058938 | 1.27E-07 | NA | mr1496 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0802058938 | NA | 3.72E-19 | mr1515 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0802058938 | NA | 5.15E-07 | mr1582_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |