\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0802054978:

Variant ID: vg0802054978 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 2054978
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, T: 0.00, others allele: 0.00, population size: 250. )

Flanking Sequence (100 bp) in Reference Genome:


CATGTACATATATACATCCCGCATAAGTACATAAACAACTAGAAAATTAAACAACCAATGTGAAATCTATAATTTATCACCCATGTGTACTCTCTGGTTC[C/T]
ATTATTTTGTCGCTTTGGATAATAACACGGTCTCAAAAACATATGTTTAGCTATGATTTTTATTATAGCATATTATCTCCATCCTAAAATATAACAACTT

Reverse complement sequence

AAGTTGTTATATTTTAGGATGGAGATAATATGCTATAATAAAAATCATAGCTAAACATATGTTTTTGAGACCGTGTTATTATCCAAAGCGACAAAATAAT[G/A]
GAACCAGAGAGTACACATGGGTGATAAATTATAGATTTCACATTGGTTGTTTAATTTTCTAGTTGTTTATGTACTTATGCGGGATGTATATATGTACATG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 94.70% 4.90% 0.47% 0.00% NA
All Indica  2759 99.30% 0.70% 0.00% 0.00% NA
All Japonica  1512 96.40% 2.20% 1.46% 0.00% NA
Aus  269 35.70% 64.30% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 99.60% 0.40% 0.00% 0.00% NA
Indica III  913 99.00% 1.00% 0.00% 0.00% NA
Indica Intermediate  786 98.90% 1.10% 0.00% 0.00% NA
Temperate Japonica  767 93.50% 4.20% 2.35% 0.00% NA
Tropical Japonica  504 99.20% 0.20% 0.60% 0.00% NA
Japonica Intermediate  241 99.60% 0.00% 0.41% 0.00% NA
VI/Aromatic  96 97.90% 2.10% 0.00% 0.00% NA
Intermediate  90 97.80% 2.20% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0802054978 C -> T LOC_Os08g04220.1 upstream_gene_variant ; 2950.0bp to feature; MODIFIER silent_mutation Average:63.612; most accessible tissue: Callus, score: 92.975 N N N N
vg0802054978 C -> T LOC_Os08g04230.1 downstream_gene_variant ; 4673.0bp to feature; MODIFIER silent_mutation Average:63.612; most accessible tissue: Callus, score: 92.975 N N N N
vg0802054978 C -> T LOC_Os08g04210.1 intron_variant ; MODIFIER silent_mutation Average:63.612; most accessible tissue: Callus, score: 92.975 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0802054978 NA 2.41E-13 mr1166 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0802054978 NA 2.43E-06 mr1230 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0802054978 7.66E-07 1.79E-23 mr1515 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0802054978 NA 1.24E-11 mr1649 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0802054978 NA 2.59E-17 mr1765 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0802054978 NA 9.96E-09 mr1166_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0802054978 5.36E-07 6.04E-25 mr1305_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0802054978 NA 5.48E-14 mr1409_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0802054978 NA 1.56E-07 mr1765_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251