| Variant ID: vg0802054978 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 2054978 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, T: 0.00, others allele: 0.00, population size: 250. )
CATGTACATATATACATCCCGCATAAGTACATAAACAACTAGAAAATTAAACAACCAATGTGAAATCTATAATTTATCACCCATGTGTACTCTCTGGTTC[C/T]
ATTATTTTGTCGCTTTGGATAATAACACGGTCTCAAAAACATATGTTTAGCTATGATTTTTATTATAGCATATTATCTCCATCCTAAAATATAACAACTT
AAGTTGTTATATTTTAGGATGGAGATAATATGCTATAATAAAAATCATAGCTAAACATATGTTTTTGAGACCGTGTTATTATCCAAAGCGACAAAATAAT[G/A]
GAACCAGAGAGTACACATGGGTGATAAATTATAGATTTCACATTGGTTGTTTAATTTTCTAGTTGTTTATGTACTTATGCGGGATGTATATATGTACATG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 94.70% | 4.90% | 0.47% | 0.00% | NA |
| All Indica | 2759 | 99.30% | 0.70% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 96.40% | 2.20% | 1.46% | 0.00% | NA |
| Aus | 269 | 35.70% | 64.30% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 98.90% | 1.10% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 93.50% | 4.20% | 2.35% | 0.00% | NA |
| Tropical Japonica | 504 | 99.20% | 0.20% | 0.60% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.60% | 0.00% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 97.90% | 2.10% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 97.80% | 2.20% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0802054978 | C -> T | LOC_Os08g04220.1 | upstream_gene_variant ; 2950.0bp to feature; MODIFIER | silent_mutation | Average:63.612; most accessible tissue: Callus, score: 92.975 | N | N | N | N |
| vg0802054978 | C -> T | LOC_Os08g04230.1 | downstream_gene_variant ; 4673.0bp to feature; MODIFIER | silent_mutation | Average:63.612; most accessible tissue: Callus, score: 92.975 | N | N | N | N |
| vg0802054978 | C -> T | LOC_Os08g04210.1 | intron_variant ; MODIFIER | silent_mutation | Average:63.612; most accessible tissue: Callus, score: 92.975 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0802054978 | NA | 2.41E-13 | mr1166 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0802054978 | NA | 2.43E-06 | mr1230 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0802054978 | 7.66E-07 | 1.79E-23 | mr1515 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0802054978 | NA | 1.24E-11 | mr1649 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0802054978 | NA | 2.59E-17 | mr1765 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0802054978 | NA | 9.96E-09 | mr1166_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0802054978 | 5.36E-07 | 6.04E-25 | mr1305_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0802054978 | NA | 5.48E-14 | mr1409_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0802054978 | NA | 1.56E-07 | mr1765_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |