\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0802032087:

Variant ID: vg0802032087 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 2032087
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ACTATAAATGCCAATAGTATATCTCTTTGATGGTGGGGACTGCTAATGAGTAAGAGTAGGCTAATAGAACCAACAACTGTTAAAAACTGTTATTCTTAGT[A/G]
GCATATATTGTGAATGTTCTGAACTTTCTTGATACGAGTTTAAGCAGGGCTAAGGCACCAATTTTGTTGTTTGGCCCCTCTACCATCTTAATGATATCAG

Reverse complement sequence

CTGATATCATTAAGATGGTAGAGGGGCCAAACAACAAAATTGGTGCCTTAGCCCTGCTTAAACTCGTATCAAGAAAGTTCAGAACATTCACAATATATGC[T/C]
ACTAAGAATAACAGTTTTTAACAGTTGTTGGTTCTATTAGCCTACTCTTACTCATTAGCAGTCCCCACCATCAAAGAGATATACTATTGGCATTTATAGT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 51.30% 48.60% 0.08% 0.00% NA
All Indica  2759 21.20% 78.70% 0.11% 0.00% NA
All Japonica  1512 98.50% 1.50% 0.00% 0.00% NA
Aus  269 76.20% 23.40% 0.37% 0.00% NA
Indica I  595 30.90% 68.90% 0.17% 0.00% NA
Indica II  465 3.90% 96.10% 0.00% 0.00% NA
Indica III  913 20.30% 79.60% 0.11% 0.00% NA
Indica Intermediate  786 25.10% 74.80% 0.13% 0.00% NA
Temperate Japonica  767 98.30% 1.70% 0.00% 0.00% NA
Tropical Japonica  504 99.00% 1.00% 0.00% 0.00% NA
Japonica Intermediate  241 98.30% 1.70% 0.00% 0.00% NA
VI/Aromatic  96 94.80% 5.20% 0.00% 0.00% NA
Intermediate  90 58.90% 41.10% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0802032087 A -> G LOC_Os08g04190.1 downstream_gene_variant ; 2367.0bp to feature; MODIFIER silent_mutation Average:84.76; most accessible tissue: Minghui63 young leaf, score: 96.503 N N N N
vg0802032087 A -> G LOC_Os08g04180.1 intron_variant ; MODIFIER silent_mutation Average:84.76; most accessible tissue: Minghui63 young leaf, score: 96.503 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0802032087 A G -0.01 0.03 0.03 0.02 0.02 0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0802032087 NA 1.37E-07 mr1593 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0802032087 NA 6.93E-13 mr1739 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0802032087 3.53E-06 NA mr1739_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0802032087 5.58E-07 1.45E-17 mr1739_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0802032087 NA 1.59E-09 mr1751_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0802032087 NA 2.33E-08 mr1758_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0802032087 NA 1.59E-07 mr1885_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251