Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0801970990:

Variant ID: vg0801970990 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 1970990
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

AAATTTTGTTAGAAAGTTTATTTCTAATTTGTCTGGAAGGTTAGAACCTTTTTTACACCATTGTTGAGATTAAAGGCCGATCAAAAGTTTACATGGGGGG[C/T]
AGAACAGCAGAAGGCTTTGGATAGTATTAAAGAATATCTTAACTCTCCTCTAGTTTTGATTCCTCCACAAAAGGGGATACCTTTTAGATTAAATCTATCG

Reverse complement sequence

CGATAGATTTAATCTAAAAGGTATCCCCTTTTGTGGAGGAATCAAAACTAGAGGAGAGTTAAGATATTCTTTAATACTATCCAAAGCCTTCTGCTGTTCT[G/A]
CCCCCCATGTAAACTTTTGATCGGCCTTTAATCTCAACAATGGTGTAAAAAAGGTTCTAACCTTCCAGACAAATTAGAAATAAACTTTCTAACAAAATTT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	92.00%	6.70%	0.63%	0.59%	NA
All Indica	2759	86.90%	11.20%	0.94%	1.01%	NA
All Japonica	1512	99.60%	0.30%	0.13%	0.00%	NA
Aus	269	98.50%	0.70%	0.74%	0.00%	NA
Indica I	595	71.90%	25.50%	2.52%	0.00%	NA
Indica II	465	97.60%	0.90%	0.65%	0.86%	NA
Indica III	913	88.30%	9.90%	0.11%	1.75%	NA
Indica Intermediate	786	90.20%	7.90%	0.89%	1.02%	NA
Temperate Japonica	767	99.30%	0.40%	0.26%	0.00%	NA
Tropical Japonica	504	100.00%	0.00%	0.00%	0.00%	NA
Japonica Intermediate	241	99.60%	0.40%	0.00%	0.00%	NA
VI/Aromatic	96	99.00%	1.00%	0.00%	0.00%	NA
Intermediate	90	96.70%	3.30%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0801970990	C -> T	LOC_Os08g04070.1	downstream_gene_variant ; 2565.0bp to feature; MODIFIER	silent_mutation	Average:32.632; most accessible tissue: Minghui63 flag leaf, score: 44.406	N	N	N	N
vg0801970990	C -> T	LOC_Os08g04060.1	intron_variant ; MODIFIER	silent_mutation	Average:32.632; most accessible tissue: Minghui63 flag leaf, score: 44.406	N	N	N	N
vg0801970990	C -> DEL	N	N	silent_mutation	Average:32.632; most accessible tissue: Minghui63 flag leaf, score: 44.406	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0801970990	1.51E-09	1.02E-18	mr1739	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801970990	1.86E-07	5.33E-14	mr1739	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801970990	NA	7.64E-06	mr1722_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801970990	1.65E-06	4.70E-17	mr1739_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801970990	NA	5.36E-13	mr1739_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801970990	NA	3.87E-07	mr1895_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801970990	NA	5.64E-06	mr1895_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251