\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0801970990:

Variant ID: vg0801970990 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 1970990
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AAATTTTGTTAGAAAGTTTATTTCTAATTTGTCTGGAAGGTTAGAACCTTTTTTACACCATTGTTGAGATTAAAGGCCGATCAAAAGTTTACATGGGGGG[C/T]
AGAACAGCAGAAGGCTTTGGATAGTATTAAAGAATATCTTAACTCTCCTCTAGTTTTGATTCCTCCACAAAAGGGGATACCTTTTAGATTAAATCTATCG

Reverse complement sequence

CGATAGATTTAATCTAAAAGGTATCCCCTTTTGTGGAGGAATCAAAACTAGAGGAGAGTTAAGATATTCTTTAATACTATCCAAAGCCTTCTGCTGTTCT[G/A]
CCCCCCATGTAAACTTTTGATCGGCCTTTAATCTCAACAATGGTGTAAAAAAGGTTCTAACCTTCCAGACAAATTAGAAATAAACTTTCTAACAAAATTT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 92.00% 6.70% 0.63% 0.59% NA
All Indica  2759 86.90% 11.20% 0.94% 1.01% NA
All Japonica  1512 99.60% 0.30% 0.13% 0.00% NA
Aus  269 98.50% 0.70% 0.74% 0.00% NA
Indica I  595 71.90% 25.50% 2.52% 0.00% NA
Indica II  465 97.60% 0.90% 0.65% 0.86% NA
Indica III  913 88.30% 9.90% 0.11% 1.75% NA
Indica Intermediate  786 90.20% 7.90% 0.89% 1.02% NA
Temperate Japonica  767 99.30% 0.40% 0.26% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 99.60% 0.40% 0.00% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 96.70% 3.30% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0801970990 C -> T LOC_Os08g04070.1 downstream_gene_variant ; 2565.0bp to feature; MODIFIER silent_mutation Average:32.632; most accessible tissue: Minghui63 flag leaf, score: 44.406 N N N N
vg0801970990 C -> T LOC_Os08g04060.1 intron_variant ; MODIFIER silent_mutation Average:32.632; most accessible tissue: Minghui63 flag leaf, score: 44.406 N N N N
vg0801970990 C -> DEL N N silent_mutation Average:32.632; most accessible tissue: Minghui63 flag leaf, score: 44.406 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0801970990 1.51E-09 1.02E-18 mr1739 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801970990 1.86E-07 5.33E-14 mr1739 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801970990 NA 7.64E-06 mr1722_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801970990 1.65E-06 4.70E-17 mr1739_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801970990 NA 5.36E-13 mr1739_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801970990 NA 3.87E-07 mr1895_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801970990 NA 5.64E-06 mr1895_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251