\
| Variant ID: vg0801970990 (JBrowse) | Variation Type: SNP |
| Chromosome: chr08 | Position: 1970990 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
AAATTTTGTTAGAAAGTTTATTTCTAATTTGTCTGGAAGGTTAGAACCTTTTTTACACCATTGTTGAGATTAAAGGCCGATCAAAAGTTTACATGGGGGG[C/T]
AGAACAGCAGAAGGCTTTGGATAGTATTAAAGAATATCTTAACTCTCCTCTAGTTTTGATTCCTCCACAAAAGGGGATACCTTTTAGATTAAATCTATCG
CGATAGATTTAATCTAAAAGGTATCCCCTTTTGTGGAGGAATCAAAACTAGAGGAGAGTTAAGATATTCTTTAATACTATCCAAAGCCTTCTGCTGTTCT[G/A]
CCCCCCATGTAAACTTTTGATCGGCCTTTAATCTCAACAATGGTGTAAAAAAGGTTCTAACCTTCCAGACAAATTAGAAATAAACTTTCTAACAAAATTT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 92.00% | 6.70% | 0.63% | 0.59% | NA |
| All Indica | 2759 | 86.90% | 11.20% | 0.94% | 1.01% | NA |
| All Japonica | 1512 | 99.60% | 0.30% | 0.13% | 0.00% | NA |
| Aus | 269 | 98.50% | 0.70% | 0.74% | 0.00% | NA |
| Indica I | 595 | 71.90% | 25.50% | 2.52% | 0.00% | NA |
| Indica II | 465 | 97.60% | 0.90% | 0.65% | 0.86% | NA |
| Indica III | 913 | 88.30% | 9.90% | 0.11% | 1.75% | NA |
| Indica Intermediate | 786 | 90.20% | 7.90% | 0.89% | 1.02% | NA |
| Temperate Japonica | 767 | 99.30% | 0.40% | 0.26% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 96.70% | 3.30% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0801970990 | C -> T | LOC_Os08g04070.1 | downstream_gene_variant ; 2565.0bp to feature; MODIFIER | silent_mutation | Average:32.632; most accessible tissue: Minghui63 flag leaf, score: 44.406 | N | N | N | N |
| vg0801970990 | C -> T | LOC_Os08g04060.1 | intron_variant ; MODIFIER | silent_mutation | Average:32.632; most accessible tissue: Minghui63 flag leaf, score: 44.406 | N | N | N | N |
| vg0801970990 | C -> DEL | N | N | silent_mutation | Average:32.632; most accessible tissue: Minghui63 flag leaf, score: 44.406 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0801970990 | 1.51E-09 | 1.02E-18 | mr1739 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0801970990 | 1.86E-07 | 5.33E-14 | mr1739 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0801970990 | NA | 7.64E-06 | mr1722_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0801970990 | 1.65E-06 | 4.70E-17 | mr1739_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0801970990 | NA | 5.36E-13 | mr1739_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0801970990 | NA | 3.87E-07 | mr1895_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0801970990 | NA | 5.64E-06 | mr1895_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |