Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0801962016:

Variant ID: vg0801962016 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 1962016
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TTTCACAAATCATGTCATCAATATCATGGCAATGTGGCGTTCATATCTCCACATGCCGCATCTCAATTACCTTCCCAAAGGTAATTGCCCAAGCATATAG[T/C]
ATTTGATAAATATGAGTATGCATGATTCTAGAATATTATTTCTAAGCATCTGTCATAGTTGACTAGGGACTCATACGTAAACATGGTTACGAAGGAATAA

Reverse complement sequence

TTATTCCTTCGTAACCATGTTTACGTATGAGTCCCTAGTCAACTATGACAGATGCTTAGAAATAATATTCTAGAATCATGCATACTCATATTTATCAAAT[A/G]
CTATATGCTTGGGCAATTACCTTTGGGAAGGTAATTGAGATGCGGCATGTGGAGATATGAACGCCACATTGCCATGATATTGATGACATGATTTGTGAAA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	46.90%	38.20%	6.28%	8.63%	NA
All Indica	2759	74.00%	6.60%	9.97%	9.42%	NA
All Japonica	1512	1.50%	98.10%	0.13%	0.20%	NA
Aus	269	42.40%	1.10%	4.09%	52.42%	NA
Indica I	595	70.40%	4.50%	7.39%	17.65%	NA
Indica II	465	81.30%	7.70%	6.24%	4.73%	NA
Indica III	913	74.20%	6.40%	11.50%	8.00%	NA
Indica Intermediate	786	72.30%	7.80%	12.34%	7.63%	NA
Temperate Japonica	767	1.80%	97.80%	0.13%	0.26%	NA
Tropical Japonica	504	1.20%	98.60%	0.00%	0.20%	NA
Japonica Intermediate	241	1.20%	98.30%	0.41%	0.00%	NA
VI/Aromatic	96	6.20%	91.70%	0.00%	2.08%	NA
Intermediate	90	33.30%	54.40%	10.00%	2.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0801962016	T -> C	LOC_Os08g04050.1	upstream_gene_variant ; 2241.0bp to feature; MODIFIER	silent_mutation	Average:36.763; most accessible tissue: Zhenshan97 flag leaf, score: 52.255	N	N	N	N
vg0801962016	T -> C	LOC_Os08g04040.1	downstream_gene_variant ; 269.0bp to feature; MODIFIER	silent_mutation	Average:36.763; most accessible tissue: Zhenshan97 flag leaf, score: 52.255	N	N	N	N
vg0801962016	T -> C	LOC_Os08g04040-LOC_Os08g04050	intergenic_region ; MODIFIER	silent_mutation	Average:36.763; most accessible tissue: Zhenshan97 flag leaf, score: 52.255	N	N	N	N
vg0801962016	T -> DEL	N	N	silent_mutation	Average:36.763; most accessible tissue: Zhenshan97 flag leaf, score: 52.255	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0801962016	NA	3.41E-21	mr1003	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801962016	4.60E-06	NA	mr1613	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801962016	NA	8.67E-12	mr1713	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251