\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0801959203:

Variant ID: vg0801959203 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 1959203
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, others allele: 0.00, population size: 259. )

Flanking Sequence (100 bp) in Reference Genome:


CTTTATGTTAAGATCTTATTACAATGAAATATGTTAGGCTTCTGTTTAATGTATTTTACTTGTCTTAATATCTTAATATAGAGTGGTATCGGAGTATTAG[C/T]
CGATACATGCTAGATCTATCTGATCGGCTATGCTATGAACATATATAGTCTTGTTGTTAATATATATTTCGATCTAAGTGATTTATACTGTCTCGGCATG

Reverse complement sequence

CATGCCGAGACAGTATAAATCACTTAGATCGAAATATATATTAACAACAAGACTATATATGTTCATAGCATAGCCGATCAGATAGATCTAGCATGTATCG[G/A]
CTAATACTCCGATACCACTCTATATTAAGATATTAAGACAAGTAAAATACATTAAACAGAAGCCTAACATATTTCATTGTAATAAGATCTTAACATAAAG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 75.90% 24.00% 0.06% 0.00% NA
All Indica  2759 60.20% 39.70% 0.11% 0.00% NA
All Japonica  1512 98.80% 1.20% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 34.30% 65.20% 0.50% 0.00% NA
Indica II  465 28.00% 72.00% 0.00% 0.00% NA
Indica III  913 93.60% 6.40% 0.00% 0.00% NA
Indica Intermediate  786 60.10% 39.90% 0.00% 0.00% NA
Temperate Japonica  767 98.40% 1.60% 0.00% 0.00% NA
Tropical Japonica  504 99.40% 0.60% 0.00% 0.00% NA
Japonica Intermediate  241 98.80% 1.20% 0.00% 0.00% NA
VI/Aromatic  96 96.90% 3.10% 0.00% 0.00% NA
Intermediate  90 77.80% 22.20% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0801959203 C -> T LOC_Os08g04040.1 upstream_gene_variant ; 493.0bp to feature; MODIFIER silent_mutation Average:28.794; most accessible tissue: Minghui63 flag leaf, score: 42.036 N N N N
vg0801959203 C -> T LOC_Os08g04030-LOC_Os08g04040 intergenic_region ; MODIFIER silent_mutation Average:28.794; most accessible tissue: Minghui63 flag leaf, score: 42.036 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0801959203 NA 5.08E-06 mr1195 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801959203 NA 6.42E-10 mr1352 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801959203 NA 5.89E-06 mr1550 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801959203 1.16E-07 1.02E-12 mr1739 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801959203 1.25E-07 9.88E-19 mr1739 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801959203 NA 5.49E-11 mr1751 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801959203 NA 1.53E-17 mr1352_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801959203 NA 2.78E-06 mr1530_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801959203 NA 3.71E-10 mr1546_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801959203 NA 3.92E-07 mr1654_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801959203 NA 6.42E-06 mr1722_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801959203 NA 3.61E-11 mr1734_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801959203 5.15E-08 8.09E-12 mr1739_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801959203 9.91E-08 3.65E-17 mr1739_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801959203 NA 2.24E-06 mr1807_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801959203 NA 1.63E-06 mr1834_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251