\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0801958097:

Variant ID: vg0801958097 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 1958097
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.98, T: 0.01, others allele: 0.00, population size: 232. )

Flanking Sequence (100 bp) in Reference Genome:


TGGAGGGCCCCACATGTCATATTCATTCCTTTTCTTCTTCCCCCACCTCTCCCTCACTCTCCTCTCCACCAACAAGTCATGAGGGGCACGCTGGTGCAGA[C/T]
GGTGTCTAGCGTGGGGGCTGCTAGCTGGTGCGTGTGTTAACGACCAAATTTGGTAATCTGAGTATCGAGGAGGAAGATCAGATCGAAGCGGAATCCAAGT

Reverse complement sequence

ACTTGGATTCCGCTTCGATCTGATCTTCCTCCTCGATACTCAGATTACCAAATTTGGTCGTTAACACACGCACCAGCTAGCAGCCCCCACGCTAGACACC[G/A]
TCTGCACCAGCGTGCCCCTCATGACTTGTTGGTGGAGAGGAGAGTGAGGGAGAGGTGGGGGAAGAAGAAAAGGAATGAATATGACATGTGGGGCCCTCCA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 84.60% 7.10% 0.32% 7.96% NA
All Indica  2759 79.80% 11.90% 0.47% 7.90% NA
All Japonica  1512 99.70% 0.20% 0.00% 0.13% NA
Aus  269 43.50% 0.70% 0.37% 55.39% NA
Indica I  595 72.10% 27.90% 0.00% 0.00% NA
Indica II  465 90.10% 0.40% 0.65% 8.82% NA
Indica III  913 79.00% 10.10% 0.55% 10.41% NA
Indica Intermediate  786 80.40% 8.50% 0.64% 10.43% NA
Temperate Japonica  767 99.60% 0.30% 0.00% 0.13% NA
Tropical Japonica  504 99.80% 0.00% 0.00% 0.20% NA
Japonica Intermediate  241 99.60% 0.40% 0.00% 0.00% NA
VI/Aromatic  96 97.90% 0.00% 0.00% 2.08% NA
Intermediate  90 90.00% 3.30% 1.11% 5.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0801958097 C -> T LOC_Os08g04040.1 upstream_gene_variant ; 1599.0bp to feature; MODIFIER silent_mutation Average:50.726; most accessible tissue: Zhenshan97 panicle, score: 65.386 N N N N
vg0801958097 C -> T LOC_Os08g04030-LOC_Os08g04040 intergenic_region ; MODIFIER silent_mutation Average:50.726; most accessible tissue: Zhenshan97 panicle, score: 65.386 N N N N
vg0801958097 C -> DEL N N silent_mutation Average:50.726; most accessible tissue: Zhenshan97 panicle, score: 65.386 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0801958097 NA 8.44E-06 mr1686 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801958097 6.59E-08 9.19E-18 mr1739 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801958097 4.72E-06 3.31E-13 mr1739 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801958097 NA 5.09E-06 mr1817 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801958097 NA 8.49E-07 mr1722_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801958097 1.63E-06 9.61E-18 mr1739_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801958097 NA 1.34E-13 mr1739_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801958097 NA 1.33E-08 mr1758_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801958097 NA 7.82E-08 mr1895_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801958097 NA 1.18E-06 mr1895_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801958097 NA 9.40E-07 mr1899_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801958097 NA 1.81E-06 mr1899_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801958097 NA 7.70E-06 mr1923_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251