\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0801912287:

Variant ID: vg0801912287 (JBrowse)Variation Type: SNP
Chromosome: chr08Position: 1912287
Reference Allele: CAlternative Allele: G,A
Primary Allele: CSecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ATGGTAAATAAGCATCGATCCGAAGGTTAAAGCATACATCGGCTGGAGGTCCGATAGCATTAAATCCACAAGATTAGATAATCAGTAAAATCTTTGTTGC[C/G,A]
ATCGGCTAAATCCAATATGTATGCAATCCTTGTAAGCTGATGCAACGTCTAGATAACTCATTGGCTGAAACCCCGATGAAACACTTATTGGCAGTCAAAA

Reverse complement sequence

TTTTGACTGCCAATAAGTGTTTCATCGGGGTTTCAGCCAATGAGTTATCTAGACGTTGCATCAGCTTACAAGGATTGCATACATATTGGATTTAGCCGAT[G/C,T]
GCAACAAAGATTTTACTGATTATCTAATCTTGTGGATTTAATGCTATCGGACCTCCAGCCGATGTATGCTTTAACCTTCGGATCGATGCTTATTTACCAT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 32.70% 3.40% 6.45% 57.34% A: 0.11%
All Indica  2759 14.60% 4.20% 9.13% 71.98% A: 0.07%
All Japonica  1512 58.60% 2.50% 2.58% 36.24% A: 0.07%
Aus  269 75.80% 0.00% 1.49% 22.68% NA
Indica I  595 13.80% 1.20% 4.03% 81.01% NA
Indica II  465 11.80% 3.00% 7.31% 77.85% NA
Indica III  913 16.10% 6.70% 13.25% 63.96% NA
Indica Intermediate  786 15.10% 4.30% 9.29% 70.99% A: 0.25%
Temperate Japonica  767 95.60% 0.10% 0.26% 4.04% NA
Tropical Japonica  504 11.90% 6.90% 5.16% 75.99% NA
Japonica Intermediate  241 38.60% 0.80% 4.56% 55.60% A: 0.41%
VI/Aromatic  96 17.70% 1.00% 3.12% 76.04% A: 2.08%
Intermediate  90 41.10% 4.40% 7.78% 46.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0801912287 C -> G LOC_Os08g03990.1 upstream_gene_variant ; 1747.0bp to feature; MODIFIER silent_mutation Average:12.444; most accessible tissue: Callus, score: 54.271 N N N N
vg0801912287 C -> G LOC_Os08g03980-LOC_Os08g03990 intergenic_region ; MODIFIER silent_mutation Average:12.444; most accessible tissue: Callus, score: 54.271 N N N N
vg0801912287 C -> A LOC_Os08g03990.1 upstream_gene_variant ; 1747.0bp to feature; MODIFIER silent_mutation Average:12.444; most accessible tissue: Callus, score: 54.271 N N N N
vg0801912287 C -> A LOC_Os08g03980-LOC_Os08g03990 intergenic_region ; MODIFIER silent_mutation Average:12.444; most accessible tissue: Callus, score: 54.271 N N N N
vg0801912287 C -> DEL N N silent_mutation Average:12.444; most accessible tissue: Callus, score: 54.271 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0801912287 NA 3.98E-07 mr1308 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801912287 NA 8.25E-07 mr1368 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801912287 NA 4.50E-07 mr1401 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801912287 NA 1.73E-07 mr1551 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801912287 NA 2.52E-08 mr1552 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801912287 NA 4.24E-08 mr1584 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801912287 2.39E-06 2.91E-13 mr1593 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801912287 NA 1.31E-07 mr1593 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801912287 NA 2.20E-16 mr1593 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801912287 NA 3.44E-06 mr1686 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801912287 1.47E-06 NA mr1739 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801912287 7.83E-09 2.60E-17 mr1739 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801912287 NA 9.69E-08 mr1916 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801912287 NA 1.92E-07 mr1942 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801912287 NA 3.19E-08 mr1156_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801912287 NA 3.72E-09 mr1235_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801912287 NA 7.25E-11 mr1350_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801912287 NA 7.52E-10 mr1361_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801912287 NA 3.67E-11 mr1368_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801912287 NA 9.31E-06 mr1483_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801912287 NA 3.76E-12 mr1593_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801912287 NA 1.94E-07 mr1593_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801912287 NA 1.23E-06 mr1663_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801912287 NA 8.35E-06 mr1722_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801912287 NA 1.41E-12 mr1739_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801912287 NA 2.16E-08 mr1746_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801912287 NA 5.13E-06 mr1853_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801912287 NA 9.70E-07 mr1929_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801912287 NA 6.29E-09 mr1952_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801912287 NA 2.53E-06 mr1966_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251