Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0801912287:

Variant ID: vg0801912287 (JBrowse)	Variation Type: SNP
Chromosome: chr08	Position: 1912287
Reference Allele: C	Alternative Allele: G,A
Primary Allele: C	Secondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

ATGGTAAATAAGCATCGATCCGAAGGTTAAAGCATACATCGGCTGGAGGTCCGATAGCATTAAATCCACAAGATTAGATAATCAGTAAAATCTTTGTTGC[C/G,A]
ATCGGCTAAATCCAATATGTATGCAATCCTTGTAAGCTGATGCAACGTCTAGATAACTCATTGGCTGAAACCCCGATGAAACACTTATTGGCAGTCAAAA

Reverse complement sequence

TTTTGACTGCCAATAAGTGTTTCATCGGGGTTTCAGCCAATGAGTTATCTAGACGTTGCATCAGCTTACAAGGATTGCATACATATTGGATTTAGCCGAT[G/C,T]
GCAACAAAGATTTTACTGATTATCTAATCTTGTGGATTTAATGCTATCGGACCTCCAGCCGATGTATGCTTTAACCTTCGGATCGATGCTTATTTACCAT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	32.70%	3.40%	6.45%	57.34%	A: 0.11%
All Indica	2759	14.60%	4.20%	9.13%	71.98%	A: 0.07%
All Japonica	1512	58.60%	2.50%	2.58%	36.24%	A: 0.07%
Aus	269	75.80%	0.00%	1.49%	22.68%	NA
Indica I	595	13.80%	1.20%	4.03%	81.01%	NA
Indica II	465	11.80%	3.00%	7.31%	77.85%	NA
Indica III	913	16.10%	6.70%	13.25%	63.96%	NA
Indica Intermediate	786	15.10%	4.30%	9.29%	70.99%	A: 0.25%
Temperate Japonica	767	95.60%	0.10%	0.26%	4.04%	NA
Tropical Japonica	504	11.90%	6.90%	5.16%	75.99%	NA
Japonica Intermediate	241	38.60%	0.80%	4.56%	55.60%	A: 0.41%
VI/Aromatic	96	17.70%	1.00%	3.12%	76.04%	A: 2.08%
Intermediate	90	41.10%	4.40%	7.78%	46.67%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0801912287	C -> G	LOC_Os08g03990.1	upstream_gene_variant ; 1747.0bp to feature; MODIFIER	silent_mutation	Average:12.444; most accessible tissue: Callus, score: 54.271	N	N	N	N
vg0801912287	C -> G	LOC_Os08g03980-LOC_Os08g03990	intergenic_region ; MODIFIER	silent_mutation	Average:12.444; most accessible tissue: Callus, score: 54.271	N	N	N	N
vg0801912287	C -> A	LOC_Os08g03990.1	upstream_gene_variant ; 1747.0bp to feature; MODIFIER	silent_mutation	Average:12.444; most accessible tissue: Callus, score: 54.271	N	N	N	N
vg0801912287	C -> A	LOC_Os08g03980-LOC_Os08g03990	intergenic_region ; MODIFIER	silent_mutation	Average:12.444; most accessible tissue: Callus, score: 54.271	N	N	N	N
vg0801912287	C -> DEL	N	N	silent_mutation	Average:12.444; most accessible tissue: Callus, score: 54.271	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0801912287	NA	3.98E-07	mr1308	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801912287	NA	8.25E-07	mr1368	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801912287	NA	4.50E-07	mr1401	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801912287	NA	1.73E-07	mr1551	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801912287	NA	2.52E-08	mr1552	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801912287	NA	4.24E-08	mr1584	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801912287	2.39E-06	2.91E-13	mr1593	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801912287	NA	1.31E-07	mr1593	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801912287	NA	2.20E-16	mr1593	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801912287	NA	3.44E-06	mr1686	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801912287	1.47E-06	NA	mr1739	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801912287	7.83E-09	2.60E-17	mr1739	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801912287	NA	9.69E-08	mr1916	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801912287	NA	1.92E-07	mr1942	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801912287	NA	3.19E-08	mr1156_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801912287	NA	3.72E-09	mr1235_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801912287	NA	7.25E-11	mr1350_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801912287	NA	7.52E-10	mr1361_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801912287	NA	3.67E-11	mr1368_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801912287	NA	9.31E-06	mr1483_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801912287	NA	3.76E-12	mr1593_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801912287	NA	1.94E-07	mr1593_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801912287	NA	1.23E-06	mr1663_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801912287	NA	8.35E-06	mr1722_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801912287	NA	1.41E-12	mr1739_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801912287	NA	2.16E-08	mr1746_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801912287	NA	5.13E-06	mr1853_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801912287	NA	9.70E-07	mr1929_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801912287	NA	6.29E-09	mr1952_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0801912287	NA	2.53E-06	mr1966_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251